-
PDF
apple_macbook_pro_a1286_mlb_d1_051-9216_13.3_retina_a1425_820-3462_sch.pdf
U2930,U2940,U2950,U29607RITICAL3100,U3110,4G_SAMSUNG_35NM_1600_S0,U3RAM_6G_ELPIDA_CH0_1600_S 6G_ELPIDA_CH0_1600_S,RAMCFG3:H,RAMCFG2:L,RAMCFG1:H,RAMCFG0:L TABLE_BOMGROUP_ITEM 333S0623 8 IC,SDRAM,2GBIT,256MX8,DDR3-1600,78FBGA U3100,U3110
in „Macbook Schaltpläne“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
manual_microvip_3_plus.pdf
00CC = address from which the reading starts (4 bytes ascii) -0001 = Number of words to be read (2 bytes ascii) -LRC = Longitudinal Redundancy Check (2 bytes ascii) -CR = 0DH (1 byte ascii) -LF = 0AH (1 byte
in „Auslesen von Microvip Messgeräten“ · Mikrocontroller und Digitale Elektronik ·
-
Datei
OptionInst_Trace.txt
52 k1394dbg 464 1828 3 52 09\12\2018-18:46:56:853 REQUEST_ASYNC_READ: OffsetHi=FFFF OffsetLo=F00004CC NumOfBytesToRead=4 nBlockSize 2048 53 k1394dbg 464 1828 3 53 09\12\2018-18:46:56:853 REQUEST_ASYNC_READ: OffsetHi=FFFF OffsetLo=F00004D0 NumOfBytesToRead=4 nBlockSize 2048 54 k1394dbg 464 1828 3 54 09
in „R&S TSMU Radio Network Analyzer“ · HF, Funk und Felder ·
-
PDF
nkat20-21.pdf
Widerstandswerte in 62 MIRA-Mikro-Containern Größe 1A weiß (eingefüllt und beschriftet) Best.Nr. € je 50 St. = 3100 SMD-Widerstände 4132/50 129.-- je 100 St. = 6200 SMD-Widerstände 4132/100 168.-- 62 Widerstandswerte in zwei MIRA-Multi-Containern (eingefüllt) Best.Nr. € je 50 St. = 3100 SMD-Widerstände 4189/50 89
-
PDF
sony_str-ks360_ks360s_ver-1.0_sm.pdf
Q1005 R3133 R3105 R3077 R3078 R3062 R3024 R3047 6 IC1014 R1145 R1165 B E L3224 R3154 R3119 R3114 R3100 R3108 R3092 R3086 R308R3073 R3026 R3025 R3043 R3048 1 51104 D1000 C3026 R3101 R3087 12 1 R3072 R3057 R3058 TP3016 R3042 R3033 IC1001 R1057 R1188 (KS360S) R 1 C1078 C3206 R3129 R3106 13 48 R3153 C1091
in „Sony STR KS360S Verstärker geht auf Standby, LED blinkt“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
D15G14E_14_030526.pdf
3020 447 SEG31 -5020 348 SEG130 -1060 398 SEG80 -3060 448 SEG30 -5060 349 SEG129 -1100 399 SEG79 -3100 449 SEG29 -5100 350 SEG128 -1140 400 SEG78 -3140 450 SEG28 -5140 6 EPSON Rev.1.4 S1D15G14 Series Unit: µm Pin Pin Pin Name X Y Pin Name X Y No. No. 451 SEG27 -5180 836.5 501 DUMMY -7186 836.5 452 SEG26
in „Nokia LCD 3510“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
Mabuchi_Motors_Complete.pdf
▯▯ҎԼ▯ Usable machine screw length 2.0 max. from motor mounting surface. WEIGHT: 51g (APPROX) RK-370CC-14280 30.0V h I N 75 3 30,000 h 50 2 20,000 0 I2. N 25 1 10,000 I Ts3 9. 2 ] ] 25 [mN·m] 50 Y [ i E N [ 250 [g·cm] 500 I R E TORQUE E C S Headquarters 430 Matsuhidai, Matsudo-shi, Chiba-ken, 270-2280
in „12 V Motor aus der Al-ko Mover Einheit M20 Ams1“ · Fahrzeugelektronik ·
-
PDF
kicad_8450_dcm_liste_neu_v3.pdf
7 segment super bright orange LED, common cathode CC56-12SRWA 4 digit 7 segment super bright red LED, common cathode CC56-12SURKWA 4 digit 7 segment hyper red LED, common cathode CC56-12SYKWA 4 digit 7 segment super bright yellow LED, common cathode CC56
in „KiCAD Eeschema, Bibliotheksdokumentation *.dcm als PDF-Datei“ · Platinen ·
-
PDF
opa847.pdf
G = +50, RG= 39.2Ω, VO= 200mV PP 78 63 60 57 MHz min B Gain Bandwidth Product (GBP) G ≥ +50 3900 3100 3000 2800 MHz min B Bandwidth for 0.1dB Gain Flatness G = +20, RL= 100Ω 60 40 35 30 MHz min B Peaking at a Gain of +12 4.5 7 10 12 dB max B Harmonic Distortion G = +20, f = 5MHz, O = 2PP 2nd-Harmonic
in „ADC für OPA847“ · Analoge Elektronik und Schaltungstechnik ·
-
Datei
M51.c
0x3186, 0x3186, 0x31A7, 0x39A7, 0x39C7, 0x39E8, 0x4209, 0x422A, 0x4A4A, 0x526B, 0x526B, 0x5A8B, 0x62CC, 0x62CC, 0x62CC, 0x732C, // 0x3FF0 (16368) pixels 0x628A, 0x49C7, 0x49A6, 0x51E7, 0x5A07, 0x6A68, 0x830B, 0x8B2B, 0x936B, 0x8B09, 0x934A, 0xABEC, 0xABEC, 0xB42D, 0xC4AF, 0xBCAF, // 0x4000 (16384) pixels
in „Astrosimulationen/Galaxienkollision mit Arduino“ · Projekte & Code ·
-
Datei
tft.c
0x19, 0x16, 0x50, 14, 0x1B, 0x31, 0x2F, 0x3F, 0x3F, 0x3E, 0x2F, 0x7B, 0x09, 0x06, 0x06, 0x0C, 0x1D, 0xCC, //Power Voltage Setting 0x1B, 1, 0x1B, //VRH=4.65V 0x1A, 1, 0x01, //BT (VGH~15V,VGL~-10V,DDVDH~5V) 0x24, 1, 0x2F, //VMH(VCOM High voltage ~3.2V) 0x25, 1, 0x57, //VML(VCOM Low voltage -1.2V) //****VCOM
in „4DLCD-32QA mit STM32 initialisieren“ · Mikrocontroller und Digitale Elektronik ·
-
Datei
Sensormodul2-3.asm
UDRE USART Data Register Empty, nicht genutzt ustxc: reti ;TXC USART, Tx Complete, nicht genutzt adc_cc: reti ;ADC Conversion Complete, nicht genutzt ee_rdy: reti ;EEPROM Ready, nicht genutzt anacom: reti ;Analog Comparator, nicht genutzt twi: reti ;Two-wire Serial Interface, nicht genutzt spmrdy: reti
in „AVR-ASM Knobelei : Bitmanipulation am LCD im 4-Bit Mode“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
MT6252.pdf
Baseband a s e f o 2.5.1 Audio Mixed-signal Blocks l R e l e 2.5.1.1 Block Descriptions i d e n t i a CC5 _ A(**) C CC3 n MCC2 _CC1 P d i a A e Ak A A A V M e C X Receiver o n _ W AU_OUT0_N Digitale nDAC AU_MOUTL (*) Filter X Headset DAC AU_MOUTR SPK_OUTN BUS Interface PLL AU_FMINR Speaker AU_FMINL X AU_VIN0
in „Amparos GPS Tacker - Pollin Schnäppchen“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
VHF-COMM.1984.2--b.pdf
)3-2 p2x(3+ p) " 3)(10·~ communication; however, it is not sut uctent 121 _ _ _ _ _ _ _ _ _ V'i F--CC...."'UNIC...T1Cf\S2.'1,!'; 3.3. The Chirp Method 3.4. The Time-Hopping Method The chirp method (pulse-FM) was mainly In publications, the so-called time-hc ppinq used in radar technology and not tor
-
PDF
VHF-COMM.1984.2.pdf
)3-2 p2x(3+ p) " 3)(10·~ communication; however, it is not sut uctent 121 _ _ _ _ _ _ _ _ _ V'i F--CC...."'UNIC...T1Cf\S2.'1,!'; 3.3. The Chirp Method 3.4. The Time-Hopping Method The chirp method (pulse-FM) was mainly In publications, the so-called time-hc ppinq used in radar technology and not tor
-
Datei
Sensormodul_2_V210_veraendert_4.asm
UDRE USART Data Register Empty, nicht genutzt ustxc: reti ;TXC USART, Tx Complete, nicht genutzt adc_cc: reti ;ADC Conversion Complete, nicht genutzt ee_rdy: reti ;EEPROM Ready, nicht genutzt anacom: reti ;Analog Comparator, nicht genutzt twi: reti ;Two-wire Serial Interface, nicht genutzt spmrdy: reti
in „AVR-ASM Knobelei : Bitmanipulation am LCD im 4-Bit Mode“ · Mikrocontroller und Digitale Elektronik ·
-
Datei
Sensormodul_2_V210_veraendert_v3.asm
UDRE USART Data Register Empty, nicht genutzt ustxc: reti ;TXC USART, Tx Complete, nicht genutzt adc_cc: reti ;ADC Conversion Complete, nicht genutzt ee_rdy: reti ;EEPROM Ready, nicht genutzt anacom: reti ;Analog Comparator, nicht genutzt twi: reti ;Two-wire Serial Interface, nicht genutzt spmrdy: reti
in „Temperaturmesssystem Sensormodul 2 mit ATmega 8 in AVR-ASM“ · Projekte & Code ·
-
PDF
S1D15605.pdf
Supply Pins No. of Pin Name I/O Function Pins V DD Power Shared with the MPU power supply terminal V CC. 13 Supply V SS Power This is a 0V terminal connected to the system GND. 9 Supply SS2 Power This is the reference power supply for the step-up voltage circuit for the 4 V Supply liquid crystal drive.
in „Pollin Grafik LCD-Modul OPTREX F-51320AE“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
Panasonic_AG-7350-7150_Service_Manual.pdf
REMOTE Connector Installation of slide rails while keeping the cable connector button pressed. • No. CC3004-99-0017) or 24" length (part No. CC3004-99-0018)part of Chassis Track. (The complete slide rail and bracket unit is not available from Panasonic.) Slide rail • When using the slide rail, remove the
in „Totalausfall Panasonic AG-7350 (nur noch Hintergrundbeleuchtung der Zeigerinstrumente)“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
Dissertation.pdf
anderer α- und β-Proteobakterien. Die vollständige Nukleotidabfolge ist in Abb. 4.5 dargestellt. M Cc Ec Ac - Cc Ec Ac - 50°C 55°C Abb. 4. 4: PCR-Produkte der PCR mit den Primern rAbF und rAbR, Annealing-Temperaturen von 50 und 55°C und verschiedenen Referenzbakterien als Template, aufgetrennt in einem Ethidiumbromid-gefärbten Agarosegel. M: 100 bp-Marker. Cc: Caulobacter crescentus ; Ec: Escherichia col; Ac:Aquabacterium commune ; (-) : Negativkontrolle. Sequenz aus dem recA-Gen von Aquabacterium commune: ACGCCCAAGGCCGAACTCGAAGGTGAAATGGGCGACGCGCTGCCCGGCCTGCAGGCCCGC
in „UVC Wasserentkeimung mit Led?“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
preis2024.pdf
Cadex C5100 Battery Tester ISO 78,42 8015 CAT 237-5130 Digitalmultimeter ohne IR ISO 56,70 8375 Catu CC-575-10/30-B Mittelspanungsprüfer ISO 82,04 7918 Catu CC-575-5/15-B Mittelspanungsprüfer ISO 82,04 7919 Catu CL-10 VD Mittelspanungsprüfer ISO 82,04 7917 Chauvin Arnoux 100 kOhm Widerstandsdekade ISO
in „PeakTech 365eff“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
HX8340-B_T__DS_preliminary_v01_080313.pdf
4 4 4 4 4 4 4 4 4 4 5 5 5 5 5 5 5 5 5 5 6 C O D D C G G R P C C C J1 V I V D V V V V V V V V C C D CC T 2 2 2 2 1 1 1 1 1 1 1 1 1 1 7 6 5 4 3 2 1 EW C SM D T CC K E OD C C C C C C C C S3 2 1 0D C C V V N VV S B B B B B B B B B B B B D D D D D D D D D DN N nF N O Y YC B SS N N N N N N N X DI I I IN /
in „SAMMELBESTELLUNG: 2"2 TFT Display mit 16bit digital interface“ · Markt ·
-
PDF
philips_chassis_qfu2.1e_la.pdf
(AC ) Check the Standby voltage Check the entire block (PC102, V , etc.) in at C301: measure 3.3 V CC Check the PFC voltage at C646 PFC present: measure 380 V to 400 V Check the entire block (V ICs, etc.) Pull the Standby pin to LOW (GND) PFC not present: measure ACin × 2 CC Check the main supply at C203: measure 12.3 V Check the entire block CC , ICs, etc.) Check the audio supply at C202: measure 12.3 V Pull the BL_ON_OFF pin to HIGH (3.3 V) Allow the power supply to start-up a few times No turn on Check the reference voltage of the LED Driver
in „Netzteil Philips LED TV reparieren??“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
Bestandsliste_mit_Preisen1.pdf
878 Stk 0,05 € 43,90 € WS-SMD50V4.7NF Kondensator SMD Vielschicht 50V 4700PF 926 Stk 0,03 € 23,15 € CC1206X7R2*2U100 Kondensator SMD X7R Vielschicht 100V 2.2uF 1206 7 Stk 0,19 € 1,31 € CC0603X7R1NF25 Kondensator SMD X7R Vielschicht 25V 1000PF 0603 7 Stk 0,05 € 0,35 € CC1206X7R10U25 Kondensator SMD X7R
in „Auflösung Elektronik Shop“ · Markt ·
-
PDF
Switch.pdf
JF15RP3GF J Blauer Betätiger/Grüne LED Vollflächig beleuchtet, quadratischer Betätiger 633-JF15AP1CC JF15AP1CC K Roter Betätiger/Rote LED 633-JF15AP1EE JF15AP1EE K Gelber Betätiger/Gelbe LED 633-JF15AP1FF JF15AP1FF K Grüner Betätiger/Grüne LED .400 JL-SERIE: BELEUCHTETE, EXTREM FLACHE TAKTILE SCHALTER
in „Ausfallursache Printtaster DeLonghi Kaffeeautomat?“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
samsung_242mp_chassis_po24fs.pdf
16V,TP 1 SA IC600 1203-003059 IC-SWITCHVOL.REG. MP1583,SOIC,8P,4.9x3.9mm,PLASTIC,1.22/21V,-,-40to+85CC,3A,1.194/1.25V,TP 1 SA IC606 1203-003059 IC-SWITCHVOL.REG. MP1583,SOIC,8P,4.9x3.9mm,PLASTIC,1.22/21V,-,-40to+85CC,3A,1.194/1.25V,TP 1 SA IC900 1204-002127 IC-VIDEOPROCESS MDIN-150,QFP,256P,28X28MM,PLASTIC
in „Defekt an Samsung 242MP TV/Monitor“ · Mikrocontroller und Digitale Elektronik ·
-
Datei
tuer_VL.c
0xFFFF, 0xFFFF, 0xFFFF, 0xFFFF, 0xFFFF, 0xFFFF, 0xFFFF, 0xFFFF, 0xFFFF, 0xFFFF, 0xCE59, 0xA534, // 0x0CC0 (3264) 0xA534, 0xEF5D, 0xFFFF, 0xFFFF, 0xFFFF, 0xFFFF, 0xFFFF, 0xFFFF, 0xFFFF, 0xFFFF, 0xFFFF, 0xFFFF, 0xFFFF, 0xFFFF, 0xFFFF, 0xFFFF, // 0x0CD0 (3280) 0xFFFF, 0xFFFF, 0xFFFF, 0xFFFF, 0xFFFF, 0xFFFF
in „ili9341 bitmpas - speicherproblem“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
Bestandsliste.pdf
0,05 € 43,90 € 1324 WS-SMD50V4.7NF Kondensator SMD Vielschicht 50V 4700PF 926Stk 0,03 € 23,15 € 1325 CC1206X7R2*2U100 Kondensator SMD X7R Vielschicht 100V 2.2uF 1206 7Stk 0,19 € 1,31 € 1326 CC0603X7R1NF25 Kondensator SMD X7R Vielschicht 25V 1000PF 0603 7Stk 0,05 € 0,35 € Bestandsliste Seite 39 von 75 POS: Nummer Kurzbezeichnung Bestand Einheit Stückpreis Positonspreis 1327 CC1206X7R10U25 Kondensator SMD X7R Vielschicht 25V 10uF 1206 9Stk 0,16 € 1,40 € 1328 TANT6.3V47U Kondensator Tantal 47uF 6V RM=2.5 20Stk 0,25 € 5,05 € 1329 TANT35V0.1U Kondensator Tantal 0.1 uF 35V RM=2.5
in „Auflösung Elektronik Shop“ · Markt ·
-
PDF
AN332-1_Programming_Guide.pdf
[15:0] ... 0xE1CB = 1 AF @ 107.8 MHz 0xE1CC = 1 AF @ 107.9 MHz 0xE0E0 = No AF exists (default) Rev. 0.8 53 AN332 Property 0x2C07. TX_RDS_FIFO_SIZE Sets the RDS FIFO size in number of blocks. Note that the value written must be one larger than
in „Si4705 und C8051F321 kommunizieren nicht“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
AF143086415692en-000101.pdf
Compressors For DCVoltage R134a | R404A | R507 | R290 | R600a 12/24/48 The widest range compressorsurrent cc.danfoss.com Hermetic Compressors for DC Voltage Part 1 BD Compressors - Product range Part I BD Compressors – Product Range............................................................................
in „Kompressor für Campingkühlschrank - elektrischer Anschluss?“ · Fahrzeugelektronik ·
-
PDF
Danfoss_Katalog_BLDC_Compressors.pdf
Compressors For DCVoltage R134a | R404A | R507 | R290 | R600a 12/24/48 The widest range compressorsurrent cc.danfoss.com Hermetic Compressors for DC Voltage Part 1 BD Compressors - Product range Part I BD Compressors – Product Range............................................................................
in „12V Kompressor Kühlbox - Steuerung defekt - eigenes Thermostat verwenden“ · Haus & Smart Home ·
-
PDF
Funkschau_Inhalt_1980-1990.pdf
2 - hochauflösende Grafik 80/7/11 ET-3400 - Steigbügelhalter(Heathkit; 6800) 80/7/96 Fakultät mit 3100 Stellen 80/22/96 Fernschreiber als Drucker für den TRS-80 80/15/76 Festkomma-Addition und -Subtraktion mit dem Z-80 80/1/93 FUNKSCHAU-Programme auf Kassetten 80/2/12 Gleichheitszeichen in Basic 80/10
-
PDF
MASM61PROGUIDE.pdf
check for a negative number or 0 before calculating the square root. .DATA a REAL4 3.0 b REAL4 7.0 cc REAL4 2.0 posx REAL4 0.0 negx REAL4 0.0 .CODE Macro Assembler 6.1 (16-bit) - MSDN Archive Edition Page 121 Using Coprocessor Instructions (C) 1992-1996 Microsoft Corporation. All rights reserved. . .
in „SumArray Proc Uses SI, Was heisst bitte das Uses bei MASM?“ · Softwareentwicklung ·