-
Datei
lcdtext_12pxl_RS232_RX.asm
für Contrast .equ LP =2 ; Latch Puls (HSync) .equ FRAME =3 ; First Line Marker (VSync) .equ M =4 ; AC Drive .equ ONOFF =5 ; LCD (VLCD) Enable ;Werte .equ Framerate =68 ; Refreshrate .equ F_CPU =16000000 ; CPU Freq .equ RX_Buffer =32 ; UART Buffer .equ CURSOR_CHAR =219 ; ASCII Zeichen das als Cursor verwendet
in „Pollin Display Optrex F-51154NF-FW-AA“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
S1D15714_Technical_Manual__E_.pdf
4290 185 SEG56 –1650 235 SEG106 1350 285 SEG156 4350 186 SEG57 –1590 236 SEG107 1410 286 SEG157 4410 187 SEG58 –1530 237 SEG108 1470 287 SEG158 4470 188 SEG59 –1470 238 SEG109 1530 288 SEG159 4530 189 SEG60 –1410 239 SEG110 1590 289 SEG160 4590 190 SEG61 –1350 240 SEG111 1650 290 SEG161 4650 191 SEG62
in „Nokia LCD 3510“ · Mikrocontroller und Digitale Elektronik ·
-
Datei
SD_DOGM_test2.s
------------------------------------- ldi _HA0,0x00 ; 0b00000000 0x00 0 sts dVarClassAvrCt1,_HA0 ;{187}{ ct1AL = 1 } ---------------------------------------------------- ldi _HA0,0x01 ; 0b00000001 0x01 1 sts dVarClassAvrCt1al,_HA0 ;{188}{ ct1min = 0 } -------------------------------------------------
in „SPI und 2 "Bausteine"“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
esp32_datasheet_en.pdf
=QFN 5*5 Connection WD=Wi-Fi b/g/n + BT/BLE Dual Mode AD=Wi-Fi a/b/g/n + BT/BLE Dual Mode CD=Wi-Fi ac/c/b/n/g + BT/BLE Dual Mode Embedded Flash 0=No Embedded Flash 2=16 Mbit Core D=Dual Core S=Single Core Figure 7: ESP32 Part Number The table below provides the ordering information of the ESP32 series
in „esp32: Stromaufnahme im deepsleep Modus veringern?“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
Cambridge_Technology_MicroMax_Series_670_Single_Axis_Board_Level_Mirror_Positioning_System.pdf
seektechnical assistancefromCambridge Technology. 12.Monitor the ACJCsignal at TP7 on an oscilloscope. AC couple the scope. Set the sensitivity to lOmV/div. Adjust the Linearity Adjustment trimpot R77 to minimize the peak-to-peak excursions of thissignal. 29 13.Repeat steps 4. - 12. above until the desired
in „3D Scanner von 3D Digital Corp - zu irgendwas zu gebrauchen?“ · Mikrocontroller und Digitale Elektronik ·
-
Datei
PIC16F886.asm
00000000' d'000' BTFSS STATUS,Z LADR_0x0066 GOTO LADR_0x007B ; !!Bank!! 0x007B - 0x087B - 0x107B - 0x187B SUBWF LRAM_0x23,W MOVLW 0x54 ; b'01010100' d'084' "T" BTFSC STATUS,Z SUBWF LRAM_0x22,W BTFSS STATUS,C GOTO LADR_0x007A ; !!Bank!! 0x007A - 0x087A - 0x107A - 0x187A LADR_0x006D MOVLW 0x05 ; b'00000101
in „Software Bügelstation“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
BeagleBoneBlack_Rev_C.pdf
29 R5 GPIO2_23 lcd_hsync gpmc_a9 gpio2[23] pr1_pru1_pru_r30_ pr1_pru1_pru_r31_ 30 R6 GPIO2_25 lcd_ac_bias_e gpmc_a11 gpio2[25] 31 V4 UART5_CTS lcd_data14 gpmc_a18 eQEP1_index mcasp0_axr1 uart5_rxd uart5_ctsn gpio0[10] 32 T5 UART5_RTS lcd_data15 gpmc_a19 eQEP1_strobe mcasp0_ahclkx mcasp0_axr3 uart5_rtsn
in „BeagleboneBlack: Sensor über I2C“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
H8-325.pdf
........................................................................................235 15.2.2 AC Characteristics...................................................................................................242 15.3 MCU Operational Timing......................................................
in „Programmer für HD6473258P10 selber bauen“ · Mikrocontroller und Digitale Elektronik ·
-
Datei
journalctl.txt
2937] type 00 class 0x0c0300 Mär 31 15:34:29 T400 kernel: pci 0000:00:1a.0: reg 0x20: [io 0x1860-0x187f] Mär 31 15:34:29 T400 kernel: pci 0000:00:1a.1: [8086:2938] type 00 class 0x0c0300 Mär 31 15:34:29 T400 kernel: pci 0000:00:1a.1: reg 0x20: [io 0x1880-0x189f] Mär 31 15:34:29 T400 kernel: pci 0000:
in „ArchLinux mountet Bootpartition nicht“ · PC Hard- und Software ·
-
Datei
lcdtext_I2C_an_480x200.asm
für Contrast .equ LP =2 ; Latch Puls (HSync) .equ FRAME =3 ; First Line Marker (VSync) .equ M =4 ; AC Drive .equ ONOFF =5 ; LCD (VLCD) Enable ;Werte .equ Framerate =68 ; Refreshrate .equ F_CPU =16000000 ; CPU Freq .equ RX_Buffer =32 ; UART Buffer .equ CURSOR_CHAR =219 ; ASCII Zeichen das als Cursor verwendet
in „Pollin Display Optrex F-51154NF-FW-AA“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
Datenblatt_Epson_S1D15G10_vom_Display_Controller.pdf
184 V2R 10887.0 128 VDDI*6 4271.0 72 185 V3R 11007.0 129 SI 4371.0 82 186 V3R 11127.0 130 SCL 4525.0 187 V3R 11247.0 131 CS 4679.0 188 V3R 11367.0 132 V DDI 4861.0 189 NC 11487.0 133 V DDI 4966.0 190 NC 11607.0 134 GND 5071.0 191 NC 11661.0 1175.5 30 137 135 GND 5176.0 192 NC 11605.0 136 GND 5281.0 193
in „The Siemens S65 132x176, 65536 color display with AVR“ · Projekte & Code ·
-
PDF
S1D15G10.pdf
184 V2R 10887.0 128 VDDI*6 4271.0 72 185 V3R 11007.0 129 SI 4371.0 82 186 V3R 11127.0 130 SCL 4525.0 187 V3R 11247.0 131 CS 4679.0 188 V3R 11367.0 132 V DDI 4861.0 189 NC 11487.0 133 V DDI 4966.0 190 NC 11607.0 134 GND 5071.0 191 NC 11661.0 1175.5 30 137 135 GND 5176.0 192 NC 11605.0 136 GND 5281.0 193
-
Datei
lcd_text_twi.asm
für Contrast .equ LP =2 ; Latch Puls (HSync) .equ FRAME =3 ; First Line Marker (VSync) .equ M =4 ; AC Drive .equ ONOFF =5 ; LCD (VLCD) Enable ;Werte .equ Framerate = 68 ; Refreshrate .equ F_CPU = 16000000 ; CPU Freq in Hz .equ RX_Buffer = 32 ; UART Buffer .equ CURSOR_CHAR= 219 ; ASCII Zeichen das als
in „Einfacher Low Cost LCD Controller für 320x240 LCD im Textmodus“ · Projekte & Code ·
-
Datei
dmesg.txt
891 MB) [ 0.000000] .init : 0xc1880000 - 0xc193a000 ( 744 kB) [ 0.000000] .data : 0xc15b473c - 0xc187f200 (2858 kB) [ 0.000000] .text : 0xc1000000 - 0xc15b473c (5841 kB) [ 0.000000] Checking if this processor honours the WP bit even in supervisor mode...Ok. [ 0.000000] SLUB: Genslabs=15, HWalign=64,
in „pc problem - festplatte setzt mehrfach an um daten zu lesen“ · PC Hard- und Software ·
-
PDF
Datenblatt_PIC12F1822.pdf
.................................................................................. 341 31.0 DC and AC Characteristics Graphs and Tables....................................................................................................................... 373 32.0 Development Support..................
in „PIC12F1822-PWM Mode“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
Datenblatt_PIC12F1822.pdf
.................................................................................. 341 31.0 DC and AC Characteristics Graphs and Tables....................................................................................................................... 373 32.0 Development Support..................
in „Interrupt-PIC12F1822“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
12F1822_1823.pdf
.................................................................................. 341 31.0 DC and AC Characteristics Graphs and Tables....................................................................................................................... 373 32.0 Development Support..................
in „Auflösung PWM-Mode“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
12F1822_1823.pdf
.................................................................................. 341 31.0 DC and AC Characteristics Graphs and Tables....................................................................................................................... 373 32.0 Development Support..................
in „8Bits und 2Bits in eine Integer-Variable“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
12F1822_1823.pdf
.................................................................................. 341 31.0 DC and AC Characteristics Graphs and Tables....................................................................................................................... 373 32.0 Development Support..................
in „Timer2 auf 10bit einstellen“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
PIC12FLF1822PIC16FLF1823.pdf
.................................................................................. 341 31.0 DC and AC Characteristics Graphs and Tables....................................................................................................................... 373 32.0 Development Support..................
in „PIC16lf1823 General purpose I/Os mit Schmitt Trigger ?“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
PIC16F1939.pdf
.................................................................................. 364 31.0 DC and AC Characteristics Graphs and Charts....................................................................................................................... 395 32.0 Development Support..................
in „MPLAB delay und xtalfreq richtig benutzen“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
HCS12COREUG.pdf
— CPDopr8a (A:B)—(M:M+1) DIR 9C dd RPf CPDopr16a or (A:B)—imm EXT BC hh ll RPO CPDoprx0_xysppc IDX AC xb RPf CPDoprx9,xysppc IDX1 AC xb ff RPO CPDoprx16,xysppc IDX2 AC xb ee ff fRPP CPD[D,xysppc] [D,IDX] AC xb fIfRPf CPD[oprx16,xysppc] [IDX2] AC xb ee ff fIPRPf CPS#opr16i CompareSP IMM 8F jj kk PO —
in „HCS12 CPU Disassembler“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
DSPIC33EP512GM710_datasheet.pdf
Independent ADC modules: Qualification and Class B Support - Configurable as 10-bit, 1.1 Msps with • AEC-Q100 REVG (Grade 1, -40°C to +125°C) Planned four S&H or 12-bit, 500 ksps with one S&H • AEC-Q100 REVG (Grade 0, -40°C to +150°C) Planned - 11, 13, 18, 30 or 49 analog inputs • Class B Safety Library
in „Probleme mit SRAM 23LCV1024“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
avr-libc-user-manual-1.8.0.pdf
nongnu.org/avr-libc/branches/avr-libc-< major>_< minor >-branch 5. Update the package version in configure.ac and commit configure.ac to SVN trunk: Change minor number to next odd value. 6. Update the NEWS file and commit to SVN trunk: Add Changes since avr-libc< this_releas> : 7. Check out a new tree for the
in „Interrupt Probleme beim Arduino“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
NEP_2037_2045_Bestaetigung.pdf
geprüft wurden folgende Interkonnektorprojekte: Projektnr. Beschreibung/ Start- und Endpunkte Von Nach AC/DC Geplante IBN P74 Vöhringen – Westtirol DE AT AC 2030 P329 Niederlangen – Großbritannien DE UK DC 2030 P678 Südlicher Landkreis Böblingen – Mettlen DE CH DC 2037 P679 Deutschland – Frankreich DE FR
-
PDF
Dissertation.pdf
anderer α- und β-Proteobakterien. Die vollständige Nukleotidabfolge ist in Abb. 4.5 dargestellt. M Cc Ec Ac - Cc Ec Ac - 50°C 55°C Abb. 4. 4: PCR-Produkte der PCR mit den Primern rAbF und rAbR, Annealing-Temperaturen von 50 und 55°C und verschiedenen Referenzbakterien als Template, aufgetrennt in einem Ethidiumbromid-gefärbten Agarosegel. M: 100 bp-Marker. Cc: Caulobacter crescentus ; Ec: Escherichia col; Ac:Aquabacterium commune ; (-) : Negativkontrolle. Sequenz aus dem recA-Gen von Aquabacterium commune: ACGCCCAAGGCCGAACTCGAAGGTGAAATGGGCGACGCGCTGCCCGGCCTGCAGGCCCGC 60 CTGATGAGCCAGGCCTTGCGCAAGCTGACGGCCAACATCAAGAAGACGAACTGCACCGTC
in „UVC Wasserentkeimung mit Led?“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
DM00135183.pdf
. . . . . . . 186 7.4.6 GPIO port output data register (GPIOx_ODR) (x = A..H) . . . . . . . . . . 187 7.4.7 GPIO port bit set/reset register (GPIOx_BSRR) (x = A..H) . . . . . . . . . 187 7.4.8 GPIO port configuration lock register (GPIOx_LCKR) (x = A..H) . . . . . 187 7.4.9 GPIO alternate function low
in „STM32F446 FMP I2C kein Open Drain möglich?!“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
Driver_Library_user_guide.pdf
octets, illustrated by the following example address. The numbers are shown in hexadecimal format. AC-DE-48-00-00-80 In this representation, the first three octets (AC-DE-48) are the Organizationally Unique Iden- tifier (OUI). This is a number assigned by the IEEE to an organization that requests a block
in „I2C Display Steuern“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
Lang_CDDA.pdf
!gltal Audio Disk Standardization Conference: Status of the Digital Audio S.525-527. Study Meeting AcJAES28(7/") July/August 1980 I van Tilburg, J.J.G.Ch. Interview 2. Dez. 1993, 6B 130 2 vgl. Guter!, F. "Compact Disc". IEEE Spectrum, 25(11), 1988, hier: S.I04 optntons ohestandardiratian of the DAD system
in „Sample Frequenz 48 KHz vs. 44 KHz“ · Digitale Signalverarbeitung / DSP / Machine Learning ·
-
PDF
Arduino_Project_Handbook_25_Practical_Projects_to_Get_You_Started.pdf
How It Works.......................................................................................187 Testing The Keypad............................................................................1 .87 The Build.........................................................................................
in „LED Driver mit µC“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
at91sam.pdf
provided to set up test. 12.5.4.1 JTAG Boundary-scan Register The Boundary-scan Register (BSR) contains 187 bits that correspond to active pins and associ- ated control signals. Each SAM7X input/output pin corresponds to a 3-bit register in the BSR. The OUTPUT bit con- tains data that can be forced on the
in „SPI-Initialisierung von zwei Geräte über den gleichen Bus“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
ATmega48PA-ATmega88PA-ATmega168PA_Datasheet.pdf
Hexadecimal values) Instruction Format Instruction/Operation Byte 1 Byte 2 Byte 3 Byte4 Programming enable $AC $53 $00 $00 Chip erase (program memory/EEPROM) $AC $80 $00 $00 Poll RDY/BSY $F0 $00 $00 data byte out Load Instructions (1) Load extended address byte $4D $00 Extended adr $00 Load program memory page
in „Probleme mit Int Capt ISR ATmega48PA“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
HM17CM4096.pdf
-(R) 8250 -1396 287 COM41 9831 135 186 VSSH(C) 5250 -1396 237 DMY103 8310 -1396 288 COM40 9831 180 187 VSSH(R) 5310 -1396 238 DMY104 8370 -1396 289 COM39 9831 225 188 DMY90 5370 -1396 239 DMY105 8430 -1396 290 COM38 9831 270 189 DMY91 5430 -1396 240 DMY106 8490 -1396 291 COM37 9831 315 190 C1+(L) 5490
in „LCD Graphik Display mit µController ansteuern“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
SAM-V71Q-SAM-V71N-SAM-V71J_Datasheet.pdf
Output Controllers (PIO) Voltage Single supply voltage from 3.0V to 3.6V Automotive Qualification AEC-Q100 grade 2 ([-40°C : +105°C] ambient temperature) Packages LQFP144, 144-lead LQFP, 20 x 20 mm, pitch 0.5 mm TFBGA144, 144-ball TFBGA, 10 x 10 mm, pitch 0.8 mm LQFP100, 100-lead LQFP, 14 x 14 mm,
in „Atmel SAMV71 CAN FD“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
PSpice_LibraryguideOrCAD.pdf
BD185 BD185 PWRBJT.OLB Power Bipolar Transistor BD186 BD186 PWRBJT.OLB Power Bipolar Transistor BD187 BD187 PWRBJT.OLB Power Bipolar Transistor BD188 BD188 PWRBJT.OLB Power Bipolar Transistor BD189 BD189 PWRBJT.OLB Power Bipolar Transistor BD190 BD190 PWRBJT.OLB Power Bipolar Transistor BD201 BD201
in „pSpice - Bauteil hinzufügen.“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
64F3048F16-Hitachi.pdf
....................................................................................... 650 21.2.2 AC Characteristics.......................................................................................... 658 21.2.3 A/D Conversion Characteristics ...................................................
in „CPU Melkanlage auslesbar? 64F3059F16“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
PIC18F46J11_39932D.pdf
FBEh/FB8h) R/W-0 R/W-0 R/W-0 R/W-0 R/W-0 R/W-0 R/W-0 R/W-0 ECCPxASE ECCPxAS2 ECCPxAS1 ECCPxAS0 PSSxAC1 PSSxAC0 PSSxBD1 PSSxBD0 bit 7 bit 0 Legend: R = Readable bit W = Writable bit U = Unimplemented bit, read as ‘0’ -n = Value at POR ‘1’ = Bit is set ‘0’ = Bit is cleared x = Bit is unknown bit 7 ECCPxASE
in „PIC18F46J11 und RTC. Quarz nötig? Anfängerfrage Übersicht verloren ;-(“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
S32K-RM.pdf
A Comparator with 8-bit DAC 1x 1x 10/100 Mbps IEEE-1588 Ethernet MAC 1x n Serial Audio Interface (AC97, TDM, I2S) 2x i a Low Power UART/LIN (LPUART) 2x 2x 3x i (Supports LIN protocol versions 1.3, 2.0, 2.1, 2.2A, and SAE J2602) u m Low Power SPI (LPSPI) 1x 2x 2x 3x o Low Power I2C (LPI2C) 1x 1x 2x C
-
PDF
PIC18Fxx2.pdf
ACKSTAT ACKDT ACKEN RCEN PEN RSEN SEN 0000 0000 137 ADRESH A/D Result Register High Byte xxxx xxxx 187,188 ADRESL A/D Result Register Low Byte xxxx xxxx 187,188 ADCON0 ADCS1 ADCS0 CHS2 CHS1 CHS0 GO/DONE — ADON 0000 00-0 181 ADCON1 ADFM ADCS2 — — PCFG3 PCFG2 PCFG1 PCFG0 00-- 0000 182 CCPR1H Capture/Compare
in „AD1 und AD2 Multiplexen (PIC18F452)“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
KlangPlusTon_2007-01.pdf
Century 7.1 (300W), neu, nähere Infos unter Tel.: D musikalischen Bereiche,Tel.: 027 35 / 52 60 01 70 / 187 65 49 oder ozillober@t-online.de 40 EXCELW18EX001,250,-EUR/Paar ;VisatonB200, HIFI-ZEITSCHRIFTEN: Stereo, Stereoplay, Audio, 180,- EUR/Paar,Tel. : 061 51 / 29 42 33 Jahrg. 2004 kpl.(12 Hefte),Tel.:027
in „Symasym hohe Ausgangsspannung“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
DometicColdMachine50-54-55-84-85-86-94-95-96-CS-NC15_IOM_4445100001_EMEA16_20xx-xx-xx.book.pdf
not touch exposed cables with your barehands. This especially applieswhen operating thedevicefromtheAC mains. NOTICE! • Never use cleaners that contain sand,acids orsolventsto clean the A evaporator. • Protect the device against rain and moisture. • Disconnectthecoolingdeviceandotherconsumerunitsfrom
in „Schaltsymbol“ · Fahrzeugelektronik ·
-
PDF
ST7735_128x160_SPI_Display.pdf
4750 -231 235 G68 3988 227 285 S384 3188 227 186 DUMMY 4772 110 236 G66 3972 110 286 S383 3172 110 187 DUMMY 4756 227 237 G64 3956 227 287 S382 3156 227 188 G162 4740 110 238 G62 3940 110 288 S381 3140 110 189 G160 4724 227 239 G60 3924 227 289 S380 3124 227 190 G158 4708 110 240 G58 3908 110 290 S379
in „ST7735 an MCU“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
samsung_242mp_chassis_po24fs.pdf
165 MHz Active Display Horizontal/Vertical 518.4(H)mm / 324(V)mm(24 INCH) ACpowervoltage&Frequency AC 90 ~ 264 Volts, 60 / 50 Hz +/- 3 Hz Power Consumption(DPMS) 150 W (less than 2W) Dimensions (W x H x D) Set 21.98 x 14.98 x 3.54 Inches (558.4 x 380.7 x 90.0 mm) (Without stand) 21.98 x 61.81 x 6.96
in „Defekt an Samsung 242MP TV/Monitor“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
sh7020.pdf
Power-Down — Sleep mode, standby mode States States Electrical 19. Electrical — Absolute maximum ratings, AC characteristics, Characteristics Characteristics DC characteristics, operation timing 1. Overview 3. Operating modes 2. CPU On-chip modules 4. Exception processing 5. Interrupt controller (INTC) 6. User
in „welche GPS-Maus ?“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
magnetic.pdf
in Ω, (2.186) when using the source current density J 0 or ∇ × (ν ∇o× A) = ∇ × T − ∇ ×0I, in Ω, (2.187) when using the impressed current vector potentialT t0 represent coils as it is introduced in (2.148). To ensure the uniqueness of the magnetic vector potential, the divergence of it can be selected
-
PDF
reference_manual.pdf
AFIO_EXTICR4) . . . . . . . . 186 9.4.7 AF remap and debug I/O configuration register2 (AFIO_MAPR2) . . . . 187 9.5 GPIO and AFIO register maps . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 188 10 Interrupts and events . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
in „I2S zwischen STM32F103RET6 und PCM3168A möglich?“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
mega644.pdf
the internally generated baud rate of the Receiver does not have a similar (see Table 16-2 on page 187) base frequency, the Receiver will not be able to synchronize the frames to the start bit. The following equations can be used to calculate the ratio of the incoming data rate and internal receiver
in „AVR Controller braucht zu viel Strom“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
ATmegaXX4.pdf
the internally generated baud rate of the Receiver does not have a similar (see Table 18-2 on page 187) base frequency, the Receiver will not be able to synchronize the frames to the start bit. The following equations can be used to calculate the ratio of the incoming data rate and internal receiver
in „Atmega644PA Timer3“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
ATM16_doc2466.pdf
Hexadecimal values) Instruction Format Instruction /Operation Byte 1 Byte 2 Byte 3 Byte4 Programming Enable $AC $53 $00 $00 Chip Erase (Program Memory/EEPROM) $AC $80 $00 $00 Poll RDY/BSY $F0 $00 $00 data byte out Load Instructions (1) Load Extended Address byte $4D $00 Extended adr $00 Load Program Memory Page
in „ISP - Pinbelegung“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
Ateme16.pdf
values) Instruction Format Instruction /Operation Byte 1 Byte 2 Byte 3 Byte 4 Programming Enable $AC $53 $00 $00 Chip Erase (Program Memory/EEPROM) $AC $80 $00 $00 Poll RDY/BSY $F0 $00 $00 data byte out Load Instructions (1) Load Extended Address byte $4D $00 Extended adr $00 Load Program Memory Page
in „Atmega16 und spi bus“ · Mikrocontroller und Digitale Elektronik ·