-
PDF
HBD855-D_Thyristor_Theory.pdf
25 V −5 V − 10 V 1N + 10 V Q4 MJ 10 V 914 510 k 10 k 430 100 14003 100 μF 2 W 5 1 W Q5 di 0.1 + 20 V 12 k + 10 V 100 L (3) MTM15N06E dt CIRCUIT μF 4N35 1/2 W 1 1N4733 0.1 μF U3 * h 5.1 V, 1 W 1N4740 + 2 4 Q3 Q10 560
in „Ansteuerschaltung Thyristor und Triac“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
MCU_-_HR8P506_Datasheet_e.pdf
LQFP48 HR8P506FHLP 42 12bit×12 8COM X 24SEG LQFP44 16-bit X 4, HR8P506FHLK 36KB 8KB 30 1 3 2 1 12bit×10 8COM X 13SEG √ LQFP32 32-bit X 1 HR8P506FHNK 30 12bit×10 8COM X 13SEG QFN32 HR8P506FHSH 26 12bit×11 8COM X 10SEG SOP28 Example: HR8P 506 F H LQ Package LQ — LQFP48 LK — LQFP32 NK — QFN32 SH — SOP28 Code
in „Re - Programmierung eines Cortex M0“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
apple_macbook_pro_a1286_mlb_d1_051-9216_13.3_retina_a1425_820-3462_sch.pdf
OMIT_TABLE NO_TEST=TRUE B A9 A9 F3 F3 805 C6992 1 C6991 1 C6990 1 6 3 C6994 1 F8 F8 4.7UF 4.7UF 4.7UF VIN BOOST 0.22UF A10 A10 F9 F9 10% 10% 10% 10% CRITICAL B1 F10 =SMBUS_BATT_SCL X5R-CERM 2 X5R-CERMV 2 X5R-CERMV 2 U6990 CERMV 2 L6995
in „Macbook Schaltpläne“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
wr2_rcm_revb.pdf
FFSE T ASCII T RAN SL AT ION N UMBE R BIN ARY C ON T E N T S IH E XADE CIMAL (.... = UN IN T E RE ST IN)G 0 43 31 3A 57 46 20 41 4C 4C 2C 23 39 30 30 30 30 C1:WFALL,#90000 16 30 30 34 35 30 00450 0 57 41 56 45 44 45 53 43 00 00 00 WAVEDESC... 32 11 00 00 00 00 00 4C 45 43 52 4F 59 5F 32 5F 32 00 ...
in „Oszi einstellen“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
LIS3DH.pdf
y, and z- axes measurements are stored in FIFO. 3.7 Auxiliary ADC The LIS3DH contains an auxiliary 10 bit ADC with 3 separate dedicated inputs. Doc ID 17530 Rev 1 17/42 Application hints LIS3DH 4 Application hints Figure 5. LIS3DH electrical connection ADC1 ADC2 Vdd 10µF 16 14 Vdd_IO 1 13 ADC3 TOP VIEW
in „Accelerometer“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
Dissertation.pdf
crescentus, 6: Enterococcus faecium (B), 7: E. faecium (DSM), 8: E. faecalis, 9: E. casseliflavus, 10: Negativ-Kontrolle. M: 100 bp-Marker. A) Vorwärtsprimer rA2F (Position 197-219) rA2F -------------------CGGAATTCTCGGGCAAGACCACC-------- 23 Pseudomonas putidanosa ATCGTCGAGATCTACGGCCCGGAATCGTCGGGTAAAACCACGCTGACCCT
in „UVC Wasserentkeimung mit Led?“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
Kemet_Tantalum_Chip_Capacitors__F3102TA_.pdf
SOLID TANTALUM CHIP CAPACITORS TANTALUM MnO COMPONENT PERFORMANCE CHARACTERISTICS (con’t.) 2 20.0 . 10.0 D z10.0 n H r 2 C f 5.0 e r t k Reference 1.0 l u e at + 25°C t 1.0 at 120 Hz o C u M f M e r c l 1.0 1.0 f l u M 100 1k 10k S Frequency — Hertz m FIGURE 6 Typical Effect of Frequency upon Dissipation
-
PDF
L5973D.pdf
15µH VOUT=3.3V 1 VIN = 4.4V to 35V VCC D1 8 L5973D STPS340U R1 SYNC. 2 5.6K 5 C2 C1 COMP 4 3 7 FB 330µF 10µF C4 10V 35V 22nF INH GND R2 CERAMIC 3.3K C3 R3 220pF 4.7K D03IN1439 January 2008 Rev 16 1/17 www.st.com 17 Contents L5973D Contents 1 Pin settings . . . . . . . . . . . . . . . . . . . . . . . .
in „Brauche Hilfe: L5973D (2.5 A switch step down switching regulator)“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
atmega644.pdf
); Main program start 0x1F03F out SPH,r16 ; Set Stack Pointer to top of RAM 0x1F040 ldi r16,low(RAMEND) 0x1F041 out SPL,r16 0x1F042 sei ; Enable interrupts 0x1FO43 <instr> xxx 10.1.1 Moving Interrupts Between Application and Boot
in „SPI-Kommunikation Atmega644 - ADS1118“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
AVR_ATmega_328PB.pdf
accessed directly, or as the Data Space locations following those of the Register File, 0x20 - 0x5F. In addition, this device has Extended I/O space from 0x60 - 0xFF in SRAM where only the ST/STS/STD and LD/LDS/LDD instructions can be used. 10.2. ALU – Arithmetic Logic Unit The high-performance AVR
in „ATmega328PB: UART(MC) empfängt falsche Daten“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
smbj.pdf
5.7 SMBJ6.0A/CA 20 50 6.0 6.70 7.05 10 10.3 61 0.048 14.8 270 0.027 5.9 SMBJ6.5A/CA 20 50 6.5 7.20 7.58 10 11.2 56 0.058 15.2 266 0.027 6.1 SMBJ8.5A/CA 20 50 8.5 9.40 9.90 1 14.4 41.7 0.096 19.5 205 0.044 7.3 SMBJ10A/CA 0.2 1 10 11.1 11.7
in „SMD Diode unbekannte Kennzeichnung“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
2599932.pdf
.016 24 5 Tooling Blank Length D .154 7 18 .018 Size Code B/L (Nom.) E .185 8 20 .020 22 8 032 .167 F .216 9 22 .022 20 10 032/036 .228 18 10 036 .224 G .234 10 24 .024 H .247 10 25 .025 16 15 045 .246 L .086 3 14 25 051 .267 12 35 061 .292 M .330 14 Material N .500 20 Code Material/Finish 10 40 061/
in „IDC connector für Kupferlackdraht“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
NCP1397.pdf
176 1.046 1.044 174 V A ) 1.042 ( u r 172 f 1.040 m r It V 1.038 170 1.036 168 1.034 1.032 166 −40 −25 −10 5 20 35 50 65 80 95 110 125 −40 −25 −10 5 20 35 50 65 80 95 110 1 25 TEMPERATURE (°C) TEMPERATURE (°C) st Figure 18. Fault Input Reference
in „Wegwerf-TV: Schaltnetzteil defekt?“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
SSD1331_v1.2.pdf
RAM12 - - - - - - - - COM60 Row 3 RAM3 Row 11 RAM11 Row 3 RAM11 - - - - - - - - COM61 Row 2 RAM2 Row 10 RAM10 Row 2 RAM10 - - - - - - - - COM62 Row 1 RAM1 Row 9 RAM9 Row 1 RAM9 - - - - - - - - COM63 Row 0 RAM0 Row 8 RAM8 Row 0 RAM8 - - - - - - - - Display examples refer (a) (b) (c) (d) (e) (f) (g) to figures
in „Spannungsreglerproblem durch Frequenzen bei Arduino Adafruit“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
ATtiny841_Datasheet.pdf
oscillator (OSCCAL1) – Reserved 0x04 - 0x06 – Reserved (5) 0x0E Lot number 2nd character 0x07 (5) 0x0F Lot number 1st character 0x10 Lot number 4th character) 0x8 0x11 Lot number 3rd character) 0x12 Lot number 6th character) 0x09 (5) 0x13 Lot number 5th character 0x14 Reserved 0x0A 0x15 Wafer number(5
in „Takt-Vorskalierungsregister beim Attiny841“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
DSPIC33EP512GM710_datasheet.pdf
F10BP3 F10BP2 F10BP1 F10BP0 F9BP3 F9BP2 F9BP1 F9BP0 F8BP3 F8BP2 F8BP1 F8BP0 0000 h o C1BUFPNT4 0426 F15BP3 F15BP2 F15BP1 F15BP0 F14BP3 F14BP2 F14BP1 F14BP0 F13BP3 F13BP2 F13BP1 F13BP0 F12BP3 F12BP2 F12BP1
in „Probleme mit SRAM 23LCV1024“ · Mikrocontroller und Digitale Elektronik ·
-
Thread
Mint 19 Cinnamon.auweia.
vor einer Woche Mint Mate installiert, da ist das nicht passiert. Schau doch mal, ob du mit Strg Alt F1 noch in eine Textkonsole kommst (ob also der Rechner noch reagiert). Mit Str Alt F7 (oder F8) solltest du wieder in die grafische Oberfläche zurück kommen. Grhard
eine Karte von DELOCK PCIExpress Card>4x external USB 3.0. Produkt-Nummer 89363 Das seht was von: 10/10-64 Linux -Kernel 3.4. Kann das ja mal unter Win entpacken und nochmal probieren. Entpacken unter Mint ging nicht.
PC Hard- und Software ·herbert · ·312 Antworten
-
PDF
gps-spec-IS_GPS_200J.pdf
4.4647E-10, equivalent to a change in the P-code chipping rate of 10.23 MHz offset by a f = -4.5674E-3 Hz. This is equal to 10.2299999954326 MHz. The nominal carrier frequencies (f ) 0hall be 1575.42 MHz, and
in „Magisches Auge für GPS-Empfänger“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
MASM61PROGUIDE.pdf
numbers short REAL4 25.23 ; IEEE format double REAL8 2.523E1 ; IEEE format tenbyte REAL10 2523.0E-2 ; 10-byte real format ; Encoded as hexadecimals ieeeshort REAL4 3F800000r ; 1.0 as IEEE short ieeedouble REAL8 3FF0000000000000r ; 1.0 as IEEE long temporary REAL10 3FFF8000000000000000r ;
in „SumArray Proc Uses SI, Was heisst bitte das Uses bei MASM?“ · Softwareentwicklung ·
-
Datei
test.ino.asm
e0 ldi r26, 0x00 ; 0 ca: b1 e0 ldi r27, 0x01 ; 1 cc: e2 ec ldi r30, 0xC2 ; 194 ce: f5 e0 ldi r31, 0x05 ; 5 d0: 02 c0 rjmp .+4 ; 0xd6 <__do_copy_data+0x10> d2: 05 90 lpm r0, Z+ d4: 0d 92 st X+, r0 d6: a0 35 cpi r26, 0x50 ; 80 d8: b1 07 cpc r27, r17 da: d9 f7 brne .-10 ; 0xd2 <__do_copy_data
in „Atmega328 1-Wire mit Timer CTC/PWM“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
sony_str-ks360_ks360s_ver-1.0_sm.pdf
ST_CLK 41 0 ST_CLK INIT R1172 100 AMP_LRCKO R1073 10k 3.3 0 ST_CE SC_INIT 12 91 DMPORT_DET IC1005 ST_CE 40 SOFT_MUTE R1173 100 3.3 R5F3640MDFAR 3.3 RDS_DATA 0.022 SC_SOFT_MUTE MAIN (KS360S) 92 DESTINATION
in „Sony STR KS360S Verstärker geht auf Standby, LED blinkt“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
LENOVO_THINKPAD_YOGA_900-13ISK_LCFC_NM-A411_BYG40_Rev1.0.pdf
3,19 M_B_CAA1 P2 CA1 DQ7 M 11 M_B_DQ47 M_B_DQ[47:40] 3 J12 VSS8 VDD1 U4 3,19 M_B_CAA2 N2 CA 2 DQ8 F11 K2 VSS9 VDD1 U6 3,19 M_B_CAA3 N3 CA 3 DQ9 F10 M_B_DQ42 L6 VSS10 VDD1 U10 3,19 M_B_CAA4 M3 F9 M_B_DQ44 M5 F3 CA4 DQ10 F8 M_B_DQ45 N4 VSS11 A8 3,19 M_B_CAA5 E3 CA 5 DQ11 E11 M_B_DQ46 N5 VSS12 VDD2 A9
in „Notebook Leistungsteil reparatur“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
HAL_STM32F1.pdf
HAL_DBGMCU_EnableDBGStopMode (void ) Function description Enable the Debug Module during STOP mode Note: On devices STM32F10xx8 and STM32F10xxB, STM32F101xC/D/E and STM32F103xC/D/E, STM32F101xF/G and STM32F103xF/G STM32F10xx4 and STM32F10xx6 Debug registers DBGMCU_IDCODE and DBGMCU_CR are accessible only in debug mode (not
in „CAN auf STM32F4“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
en.DM00091010.pdf
® ® ARM Cortex -M0 technical reference manual, available from ARM website at www.arm.com STM32F0xx Cortex-M0 programming manual (PM0215) STM32F030x4/x6/x8/xC and STM32F070x6/xB datasheets available from STMicroelectronics website at www.st.com April 2017 DocID025023 Rev 4 1/779 www.st.com 1 Contents
in „EFM32F030 und Standby“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
XBEE3_UserGuide.pdf
the coordinator's 64-bit address is 0x0013A200404A2244. The following transmit request API frame (0x10) sends an ASCII 1 to the coordinator: 7E 00 0F 10 01 0013 A200 404A 2244 0000 0000 31 18 Example: Send a broadcast transmission In this example, a '\r' refers to a carriage return character. Digi XBee
in „XBEE3 Home Automation“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
ibm_thinkpad_t42_apollo_rev0.49_sch.pdf
< 14.3J< 13.3B< 43 R512 1005 1 2 10 5% 1/16W E8 SDQ43 SCS1# F7 1 44 10 5% 1/16W R552 1005 1 2 E11 SDQ44 SCS2# F9 2 45 1 2 10 5% 1/16W R581 1005 B9 SDQ45 SCS3# E7 3 4 46 R514 1005 1 2 10 5% 1/16W B7 SDQ46 4 47 10 5% 1/16W R553 1005 1 2
in „Lenovo T42 Ladeelektronik spielt verrückt“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
toshiba_satellite_l755.pdf
0.1U/16V_4Y 5 S 1 5 3 1 E3A 1214 VCC_XD D 2 CN26 D 10 SD-VCC 8 SD_DAT0 R276 33/F_4 SD_DAT0_R 3 SD-DAT0 SD_D1 R275 33/F_4 SD_D1_R 2 SD-DAT1 G B2A 10/05 SD_D2 R280 33/F_4 SD_D2_R 20 SD-DAT2 - SD_D3/MS_D1 R279 33/F_4 SD_D3/MS_D1_R 18 SD-DAT3 R SD_CLK/MS_D2
-
PDF
_Elmos__981_03.pdf
this current is positive from IV208) 0 20 mA the supply to the output V output capacitance L =330µH C 10 47 0.6 · C µF CC SPS VCC,L330µ ST V CCtput capacitance LSPS000µH C VCC,L1000µ 68 100 0.6 · ST µF 2) C VCCequivalent series resistance LSPS30µH RESR,CVCC,L330µ.2 0.5 0.8 Ω C VCCequivalent series resistance
in „Exposed Pad anschließen? (ATSAMD20E18A-MU und ELMOS E981.03)“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
_ATSAMD20E18A-MU.pdf
slaves • 32-bit data bus • Operation at a one-to-one clock frequency with the bus masters 10.3.2 Configuration High-Speed Bus SLAVES A B C g g g s r r r M F B B B R a P P P l r - - - n t H H H e I A A A I 0 1 2 3 4 SLAVE ID MASTER ID e S a R CM0+ 0 - T l S M M DSU DSU 1 Table 10-4. Bus Matrix
in „Exposed Pad anschließen? (ATSAMD20E18A-MU und ELMOS E981.03)“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
Switch.pdf
SP4-PL2-DC5V D 10 5 4 Form C Plug-In ST-SERIE Für größere Mengen als aufgelistet, bitte telefonisch ein Angebot einholen. 769-ST1-DC12V-F ST1-DC12V-F E 8 12 1 Form A/1 Form B PCB 769-ST1-DC24V-F ST1-DC24V-F E 8 24 1 Form
in „Ausfallursache Printtaster DeLonghi Kaffeeautomat?“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
BobBeckPaper.pdf
MCM Electronics, Centerville, OH 45459. (800) 543-4330 catalog # 50-940, #16 gauge, 0.58Ω, 2.5mH, 2-f ” dia., $10.65 Strobe modification consists simply of wiring the finished applicator coil with 4' ft. leads in series between either flash tube electrode. Be extremely cautious when working with case
in „Niederfrequenz 3,93 Hz Rechtecksignal Shchaltung messen - Hilfe?“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
STM32H7-Disco_full.PDF
R13632 1 R139 2 GND +5V PI41 Vcc Q6 PU46 PI10 P162 PR30 PI30 1 1 Q7 PU47 R1383 R142 P0 PI PI10 Gnd Q7S PU49 PI10 P182 PR40 PI40 CO131 C132 P02.2uF PI 100nF 74HC595D 1 R14042 1k0 C 2 2 PI10 P102 C 2k0 COR4 GND PR401PI40 NLoo 1k0 Lo p2 GND 1 R14112
in „STM32H7-Disco erster Test“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
DisAsm-MI6311.pdf
EQU $10D522 EXT_06F4 EQU $10D526 EXT_06F5 EQU $10D52A EXT_06F6 EQU $10D52E EXT_06F7 EQU $10D532 EXT_06F8 EQU $10D536 EXT_06F9 EQU $10D546 EXT_06FA EQU $10D55E EXT_06FB EQU $10D562 EXT_06FC EQU $10D5E6 EXT_06FD
in „Suche Simulator für Motorola 68k“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
SSD1327-datasheet.pdf
S C # # : VSS 15V C E D R DR [ [GND] V CC VCI R ( E D Voltage atREF≈ V CC– 3V. For VCC= 15V, REF = 10uA: # R1 = (Voltage at I - V ) / I R REF SS REF ≈ (15 - 3(1)/ 10uA = 1.2M(1) C1 = C2: 1uF , C3 = C4: 4.7uF Pin connected to MCU interface: D0~D7, E, R/W#, D/C#, CS#, RES# Pin internally connected toCI
in „OLED Stromverbrauch“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
file.pdf
EFC, which correspond to a driven distance of ca. 120,000 km. Figure 86. (a-c) Capacity fade and (d-f) resistance increase for up to 1200 EFC with unrestricted regenerative braking, different charging voltages, and depths of discharge of 20%, 41%, and 6N% C . (For N1% C at 40°C and 10°C, the relative
in „Pedelec: Akku und Controller verklebt - ist das rechtens ?“ · Fahrzeugelektronik ·
-
Datei
Noname.map.txt
0x10 Drivers/STM32F0xx_HAL_Driver/stm32f0xx_hal.o .text.HAL_DBGMCU_DisableDBGStandbyMode 0x0000000000000000 0x10 Drivers/STM32F0xx_HAL_Driver/stm32f0xx_hal.o .text 0x0000000000000000 0x0 Drivers/STM32F0xx_HAL_Driver
in „Problem mit STM32F103 und RAM-Größe“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
SCF5740-20_4xDotmatrix_LED.pdf
14 22 µF 39 TAN XTAL1 P0.0 ID + 19 U1 VCC 10 VCC 8031 19 RST CLKSEL 21 GND 8 1 RST 2 CLK I/O .01 µF 9 P1.0 20 Figure 13. Display Interface with Motorola 68HC05C4 Microprocessor (using SPI port) VCC VCC 15 SDCLK GND 40 PA0 11 13 LD DATA 14 38 OSC1 10 22 µF PA1 33 ID TAN SCLK + MOSI 32 VCC 10 OSC2 19 RST CS 21 39 2 GND CLK I/O8 .01 µF VCC U1 68HC05C4 1 RST 9 PA2 20 Figure 14. Cascading Multiple Displays RST VCC RST CLK I/O CLK SEL 14 more displaysRST
in „[V] Intelligente LED-Matrix-Displays, HDSP 2112, SCF 5740, PD 2435“ · Markt ·
-
PDF
Reference_Manual.pdf
double-word PCROP area for all memory. PCROP2 End address option bytes Flash memory address: 0x1FFF F810 ST production value: 0xFFFF FFFF 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 Res. Res. Res. Res. Res. Res. Res. Res. Res. Res. Res. Res. Res. Res. Res. Res. 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1
in „STM32G474RE UART“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
XBSM6T_DATA_E.pdf
characteristics, parameter values (T = 25 °C) amb V @ I V @ I RM @ VRM(1) VBR @ IR(2) CL PP CL PP αT (4) C(5) 10/1000 µs3) 8/20 µs3) Order code max min nom max max max max typ µA µA V V V V mA V A V A 10-4/°C pF (Tj=25°C) jT =85°C) SM6T6V8A/CA 10 50 5.8 6.45 6.8 7.14 10 10.5 57 13.4 298 5.7 4000 SM6T7V5A/CA 10 50 6.4 7.13 7.5 7.88 10 11.3 53 14.5 276 6.1 3700 SM6T10A/CA 1 10 8.55 9.5 10 10.5 1 14.5 41 18.6 215 7.3 2800 SM6T12A/CA 0.5 1 10.2 11.4 12 12.6 1 16.7 36 21.7 184 7.8 2300 SM6T15A/CA 0.5 1 12.8 14.3 15 15.8 1 21.2 28 27.2
-
PDF
GD32VF103_User_Manual_EN_V1.0.pdf
0x2001 8000 - 0x2001 BFFF Reserved 0x2000 5000 - 0x2001 7FFF SRAM 0x2000 0000 - 0x2000 4FFF 0x1FFF F810 - 0x1FFF FFFF Reserved 0x1FFF F800 - 0x1FFF F80F Option Bytes 0x1FFF B000 - 0x1FFF F7FF Boot loader 0x1FFF 7A10 - 0x1FFF AFFF Reserved 0x1FFF 7800 - 0x1FFF 7A0F Reserved 0x1FFF 0000 - 0x1FFF 77FF
in „STM32F103C8T6 => GD32VF103C8T6“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
STC15-English.pdf
COM + 1 C1+ Vcc 16 10μF + Vcc 3 M 0.1μF 2 V+ Gnd 15 Gnd 3 C1- T1OUT 14 PC_RxD(COM Pin2) 5 C 4 C2+ R1IN 13 PC_TxD(COM Pin3) T 0.1μF 5 C2- R1OUT 12 MCU_RxD(P3.0) S 6 V- T1IN 11 MCU_TxD(P3.1) 0.1μF7 T2OUT T2IN 10 8 R2IN R2OUT
in „Testbericht Elektronische Last“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
LED_Display_driver_chip_SSD1306_DataSheet.pdf
Row4 RAM12 - - - - - - - - COM60 Row3 RAM3 Row11 RAM11 Row3 RAM11 - - - - - - - - COM61 Row2 RAM2 Row10 RAM10 Row2 RAM10 - - - - - - - - COM62 Row1 RAM1 Row9 RAM9 Row1 RAM9 - - - - - - - - COM63 Row0 RAM0 Row8 RAM8 Row0 RAM8 - - - - - - - - Display examples (a) (b) (c) (d) (e) (f) (g) (a) (b) (c) (d) (
in „SSD1306/1309 Library zum Darstellen von Text auf OLED Displays“ · Projekte & Code ·
-
PDF
LED_Display_driver_chip_SSD1306_DataSheet.pdf
Row4 RAM12 - - - - - - - - COM60 Row3 RAM3 Row11 RAM11 Row3 RAM11 - - - - - - - - COM61 Row2 RAM2 Row10 RAM10 Row2 RAM10 - - - - - - - - COM62 Row1 RAM1 Row9 RAM9 Row1 RAM9 - - - - - - - - COM63 Row0 RAM0 Row8 RAM8 Row0 RAM8 - - - - - - - - Display examples (a) (b) (c) (d) (e) (f) (g) (a) (b) (c) (d) (
in „Spannungsversorgung Arduino läuft nicht über Vin oder 5V-Pin“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
GIMP_Handbuch_de.pdf
.Sattigung entfernen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 276 9.10.18.Invertieren . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 276 9.10.19.Das Untermenu Autom”tisch“ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 276 9.10.20.Egalisieren . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 277 9.10.21.Automatische Kontrastspreizung . . . . . . . . . . . . . . . . . . . . . . . . . .
in „Wie zwei Bilder wie Folien übereinanderlegen ?“ · PC Hard- und Software ·
-
PDF
PCF8591.pdf
bit A/D and D/A converter PCF8591 12 D/A CHARACTERISTICS V = 5.0 V; V = 0 V; V = 5.0 V; V = 0 V; R = 10 k ; C = 100 pF; T = −40 °C to +85 °C unless otherwise DD SS REF AGND L L amb specified. SYMBOL PARAMETER CONDITIONS MIN. TYP. MAX. UNIT Analog output VOA output voltage no resistive load VSS − VDD V R
in „I2C Analog Mux/Demux im DIP gesucht“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
SSD1327-datasheet.pdf
S C # # : VSS 15V C E D R DR [ [GND] V CC VCI R ( E D Voltage atREF≈ V CC– 3V. For VCC= 15V, REF = 10uA: # R1 = (Voltage at I - V ) / I R REF SS REF ≈ (15 - 3(1)/ 10uA = 1.2M(1) C1 = C2: 1uF , C3 = C4: 4.7uF Pin connected to MCU interface: D0~D7, E, R/W#, D/C#, CS#, RES# Pin internally connected toCI
in „OLED-Display SPI Psoc4“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
AtMega644P_Datasheet.pdf
); Main program start 0x1F03F out SPH,r16 ; Set Stack Pointer to top of RAM 0x1F040 ldi r16,low(RAMEND) 0x1F041 out SPL,r16 0x1F042 sei ; Enable interrupts 0x1FO43 <instr> xxx 10.1.1 Moving Interrupts Between Application and Boot
in „Alkoholmessgerät programmieren“ · Mikrocontroller und Digitale Elektronik ·
-
Datei
disas.txt
da: 41 93 st Z+, r20 dc: 2a 30 cpi r18, 0x0A ; 10 de: 98 f3 brcs .-26 ; 0xc6 e0: e8 ed ldi r30, 0xD8 ; 216 e2: f1 e0 ldi r31, 0x01 ; 1 e4: 0b e0 ldi r16, 0x0B ; 11 e6: 41 93 st Z+, r20 e8: 0a 95 dec r16 ea: e9 f7
in „Audio Spektrum Analyzer mit ATtiny85“ · Projekte & Code ·
-
PDF
STC12C2052AD-english.pdf
resistor connect to ground.C1 and R1 replaced by 1K But R/C reset circuit is also suggest to reserve. 10μF+ C1 1 RST VCC 20 Vin System power/5V/3V 10K 2 P3.0/RxD ADC7/SCLK/P1.7 19 Power On SW1 C2<33pF 3 P3.1/TxD ADC6/MISO/P1.618 C6 + C5 4 XTAL2 ADC5/MOSI/P1.517 0.1μF 10μF X1 5 XTAL1 ADC4/SS/P1.416 . C3<
in „Uhrzenbausatz mit At89C2051 funktioniert nicht“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
DSAIH000309343.pdf
Signal Symbol Condition Min. Typ. Max. Unit FR delay time FR tDFR CL = 50pF -0.1 - 0.7 ns F1,F2 delay time F1,F2 tDF1,tF2 -0.1 - 0.7 ns SYNC delay time SYNC DSYNC -0.1 - 0.7 ns 78 EPSON S1D15721 Series Technical Manual (Rev.2.1) 10. TIMING CHARACTERICTICS Table 10.12 Input Timing
in „Pollin Display VL-FS-COG-VLGEM1277-01“ · Mikrocontroller und Digitale Elektronik ·