-
Thread
Mint 19 Cinnamon.auweia.
vor einer Woche Mint Mate installiert, da ist das nicht passiert. Schau doch mal, ob du mit Strg Alt F1 noch in eine Textkonsole kommst (ob also der Rechner noch reagiert). Mit Str Alt F7 (oder F8) solltest du wieder in die grafische Oberfläche zurück kommen. Grhard
eine Karte von DELOCK PCIExpress Card>4x external USB 3.0. Produkt-Nummer 89363 Das seht was von: 10/10-64 Linux -Kernel 3.4. Kann das ja mal unter Win entpacken und nochmal probieren. Entpacken unter Mint ging nicht.
PC Hard- und Software ·herbert · ·312 Antworten
-
PDF
AD9952arduino.pdf
4B7F 556 1.000 53E2 557 2.000 A7C5 558 3.000 FBA8 559 4.000 14F8B 560 5.000 1A36E 561 6.000 1F751 562 7.000 24B33 563 8.000 29F16 564 9.000 2F2F9 565 10.000 346DC 566 20.000 68DB8 567 30.000 9D495 568 40.000
in „DDS-Chip mit einem AVR ansprechen“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
BD135_137_139_3.pdf
BD135-10; BD137-10; BD139-10 (see Fig.2) 63 − 160 BD135-16; BD137-16; BD139-16 100 − 250 V collector-emitter saturation volI = 500 mA; I = 50 mA − − 0.5 V CEsat C B VBE base-emitter voltage IC= 500 mA; VCE =
in „Alternative BC327 und 337“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
TDA2030.pdf
dB f = 40 to 15,000 Hz 0.1 0.5 % B Power Bandwidth G v 30 dB 10 to 140,000 Hz (-3 dB) Po= 12W R L= 4 Ri Input resistance (pin 1) 0.5 5 M G Voltage gain (open loop) 90 dB v G v Voltage gain (closed loop) f
in „Verstärker für Lernpaket "Elektronik mit ICs" von Franzis“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
semicon.pdf
0603 1400 x 2,2nF / 100V kerámia 1206 2500 x 10nF / 15V kerámia 0603 3000 10nF / 25V kerámia 0603 3500 x 10nF / 50V kerámia 0805 4000 x 18nF / 16V polietilén 0805 2700 x 47nF / 50V kerámia 0805 1500 x 47nF / 100 kerámia
in „4" TFT für 7,97€“ · Markt ·
-
PDF
datasheet.pdf
DISCRETE SEMICONDUCTORS DATA SHEET handbook, halfpage M3D329 KMZ10A Magnetic field sensor Product specification 1998 Mar 24 Supersedes data of 1996 Nov 08 File under Discrete Semiconductors, SC17 Philips Semiconductors Product specification Magnetic field sensor KMZ10A DESCRIPTION The KMZ10A is an extremely sensitive magnetic field sensor, employing the magnetoresistive effect of thin-film permalloy. Its properties enable this sensor to be used in a, halfpagey wide range of applications
in „KFZ Start/Ladegerät Amperemeter tauschen“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
device_list_hilo_all03_v9-12.pdf
MB98A90912 *MB98A90913 *MB98A91021 *MB98A91022 *MB98A91023 *MB98A91121 *MB98A91122 *MB98A91123 MBM29F002B MBM29F002NB MBM29F002NT MBM29F002SB MBM29F002ST MBM29F002T *MBM29F016 *MBM29F080PF *MBM29F080PFTN *MBM29F200BA *MBM29F200TA *MBM29F400B *MBM29F400T *MBM29F800B *MBM29F800T *MBM29LV002B *MBM29LV002T
in „PROM programmieren“ · Mikrocontroller und Digitale Elektronik ·
-
Datei
PinKlasse_klassisch_toggle.ino.elf.txt
e0 ldi r26, 0x00 ; 0 b2: b8 e2 ldi r27, 0x28 ; 40 b4: e6 e2 ldi r30, 0x26 ; 38 b6: f4 e0 ldi r31, 0x04 ; 4 b8: 02 c0 rjmp .+4 ; 0xbe <__do_copy_data+0x10> ba: 05 90 lpm r0, Z+ bc: 0d 92 st X+, r0 be: a4 30 cpi r26, 0x04 ; 4 c0: b1 07 cpc r27, r17 c2: d9 f7 brne .-10 ; 0xba <__do_copy_data
in „Buchempfehlung C++ und MCUs“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
OM5610_2_1_.pdf
shifts and accepts one bit into LSB. At CLCK LOW the microcontroller writes data F.13 213 102400 (see Fig.3). F.12 212 51200 To write the entire shift register 25 clock pulses are F.11 211 25600 10 necessary. F.10 2 12800 F.9 29 6400 F.8 28 3200 F.7 27 1600 F.6 26 800 5 F.5 2 400 F
-
PDF
OM5610_2_1_.pdf
shifts and accepts one bit into LSB. At CLCK LOW the microcontroller writes data F.13 213 102400 (see Fig.3). F.12 212 51200 To write the entire shift register 25 clock pulses are F.11 211 25600 10 necessary. F.10 2 12800 F.9 29 6400 F.8 28 3200 F.7 27 1600 F.6 26 800 5 F.5 2 400 F
in „[V] FM Tuner OM5610“ · Markt ·
-
PDF
OM5610_2_1_.pdf
shifts and accepts one bit into LSB. At CLCK LOW the microcontroller writes data F.13 213 102400 (see Fig.3). F.12 212 51200 To write the entire shift register 25 clock pulses are F.11 211 25600 10 necessary. F.10 2 12800 F.9 29 6400 F.8 28 3200 F.7 27 1600 F.6 26 800 5 F.5 2 400 F
-
PDF
OM5610.pdf
shifts and accepts one bit into LSB. At CLCK LOW the microcontroller writes data F.13 213 102400 (see Fig.3). F.12 212 51200 To write the entire shift register 25 clock pulses are F.11 211 25600 10 necessary. F.10 2 12800 F.9 29 6400 F.8 28 3200 F.7 27 1600 F.6 26 800 5 F.5 2 400 F
in „[V] FM Tuner OM5610“ · Markt ·
-
PDF
182853-da-01-en-kmi_151t_drehzahlmesser.pdf
) current output signal high see Figs 6 and 8 11.2 14.0 16.8 mA r output signal rise time CL= 100 pF; see Fig.9; 10 to 90% value − 0.5 − s t output signal fall time C = 100 pF; see Fig.9; 10 to 90% value − 0.7 − s f L d switching delay time between stimulation pulse (generated − 1 − s by a coil) and
in „Drehzahlmesser für Drehbank“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
KMI_151T.pdf
) current output signal high see Figs 6 and 8 11.2 14.0 16.8 mA r output signal rise time CL= 100 pF; see Fig.9; 10 to 90% value − 0.5 − s t output signal fall time C = 100 pF; see Fig.9; 10 to 90% value − 0.7 − s f L d switching delay time between stimulation pulse (generated − 1 − s by a coil) and
in „Fragen zur Magnetkraft?“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
kmi_151t.pdf
) current output signal high see Figs 6 and 8 11.2 14.0 16.8 mA r output signal rise time CL= 100 pF; see Fig.9; 10 to 90% value − 0.5 − s t output signal fall time C = 100 pF; see Fig.9; 10 to 90% value − 0.7 − s f L d switching delay time between stimulation pulse (generated − 1 − s by a coil) and
in „Signal am Zündkabel abgreifen ?!“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
KMI15.pdf
) current output signal high see Figs 6 and 8 11.2 14.0 16.8 mA r output signal rise time CL= 100 pF; see Fig.9; 10 to 90% value − 0.5 − s t output signal fall time C = 100 pF; see Fig.9; 10 to 90% value − 0.7 − s f L d switching delay time between stimulation pulse (generated − 1 − s by a coil) and
in „KMI15/1 Drehzahlsensor reagiert nicht“ · Mikrocontroller und Digitale Elektronik ·
-
Thread
Arbeiten unter Spannung
reichlich schwierig. Schon der vorgeschriebe VDE-Schraubenzieher (Verzeihung: -dreher) (mit min. 10 kV Prüfspannung?) kommt wg. seiner Schaftdicke oft nicht an die Schrauben (falls noch vorhanden) heran ...
erforderliche Sorgfalt außer Acht gelassen. Zur Rechtsfolge siehe https://www.gesetze-im-internet.de/bgb/__276.html
Analoge Elektronik und Schaltungstechnik ·Micha W. · ·105 Antworten
-
PDF
BZX399.pdf
3.00 215 3.0 7V5 7.13 7.88 0.15 3.60 170 3.0 8V2 7.79 8.61 0.15 4.25 150 3.0 9V1 8.65 9.56 0.10 5.00 120 3.0 10 9.50 10.50 0.10 5.80 110 3.0 11 10.45 11.55 0.11 6.70 110 2.5 12 11.40 12.60 0.12 7.65 105 2.5 13 12.35 13.65 0.13 8.60 105 2.5 15 14.25 15.75 0.15 10.50 100 2.0 Note 1. V Z V Zt 100
in „Frage Mosfet“ · Analoge Elektronik und Schaltungstechnik ·
-
Datei
xTalk_10-01-2022_211035_MYL6F04233.txt
xTalk Version 6.7.0.0 Log File Start Time: 10/01/2022 21:10:35 Computer Name: TESTPC Operating System: MS Windows Sever 2012 or Windows 8 Version 6.2 (Build 9200) ____________________________________________________________ Start: 10/01/2022 21:10:35 Device: QUANTUM DLT-V4 MYL6F04233 0:0:255 Start: Device_Health_Check ----------- Script Build Information ------------- V:21.02 \DATA\QUANTUM\SRC\XTALK\TRUNK\DLTSAGE\SHARED\SCRIPTS\TESTS\DEVICE HEALTH
-
PDF
ECO7213.pdf
of H.F. Wideband Power Transformers; Part II ECO7213 Vsec B max = - ωmin× A × nsec 2 102 in which A = 31.5 mm for this core, so: Bmax = - 6 —6 = 140 gauss at 1.6 MHz 2π × 1.6× 10 × 31.5 × 10 × 23 This gives
in „Stackpole Ferrit Kerne für RF Verstärker“ · HF, Funk und Felder ·
-
PDF
FRAM_Block_D.pdf
RepPCF8583ByF2013.s43 * - Printed on 20.10.2022 07:24:57 217 ;------------------------------------------------------------------------------- 218 RSEG INFOD ; Define Flash segment 01000h ~ 0103Fh 219 ; Internal (Sensor
in „Fragen zum PCF8583 als Event Counter“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
Handbuch_SE4942_Eprom_Programmer_pdfa-2b_150dpi.pdf
Summen- 1 SET Anzeige der Checksumme im kontrolle RAM P SET Anzeige der Summe in Seite P (P=0 bis F) FA ” LA SET Anzeige der Summe zwischen FA und LA Start- 2 SET Anzeige von ST bei Start, adresse SP bei Stop ST SET Setzen der Startadresse ST. Stop- 3 SET Anzeige von ST bei Start, adresse SP bei Stop
-
PDF
FM_AM-Tuner_TEA5757HL_5759HL_1.pdf
38 36 18 19 22 N o N L6 22 pF 47 17 2.2 F 10 k F ( (6) FM FM FM FM FM FM PILOT O S 46 FRONT-END OSCILLATOR MIXER IF1 IF2 DETECTOR DETECTOR 26 MO/ST R T 30 19 kHz 470 nF M R DATA 29 13 A WRITE-ENABLE 31 2.2 k 470 nF T ) V PLL 10 O
in „Autoradio selber bauen.“ · Mikrocontroller und Digitale Elektronik ·
-
Thread
AVR und der Umgang mit C++
1<<pinNr ; 106: 88 e0 ldi r24, 0x08 ; 8 108: 8b b9 out 0x0b, r24 ; 11 10a: 05 c0 rjmp .+10 ; 0x116 <_ZN6RX58089spiEnableEb+0x1c> 10c: 82 e0 ldi r24, 0x02 ; 2 10e: 8a 95 dec r24 110: f1 f7 brne .-4 ; 0x10e <_ZN6RX58089spiEnableEb
r16, 0xFF ; 255 2e0: 1f 4f sbci r17, 0xFF ; 255 2e2: 00 31 cpi r16, 0x10 ; 16 2e4: 11 05 cpc r17, r1 2e6: 69 f7 brne .-38 ; 0x2c2 <_ZN7Max74564initEv+0x54> }
Mikrocontroller und Digitale Elektronik ·Stefan · ·57 Antworten
-
Datei
2_FracNEON.txt
272 VMOV S9,R12 ;transfer to Q2.2 -> S9 273 MOV R7,R10 ;save new x in new plot_x2 274 VLDR S1,delta_sp ;use S1 as not needed anymore 275 VMOV S5,R10 ;use S5 for R10, as not needed anymore 276 VCVT.F32.U32 S5,S5 277 VMUL.F32 S1,S1,S5 ;new x2 = x2*d 278 VLDR
in „Raspberry Pi als "dicker" Mikrocontroller“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
ti_aktiv_filter_sloa088.pdf
to 80 dB/decade. Note: Filter response graphs plot gain versus the normalized frequency axis Ω (Ω = f/C). Active Filter Design Techniques 16-3 Fundamentals of Low-Pass Filters 0 –10 –20 1st Order Lowpass d –30 — n a –40 G 4th Order Lowpass — A –50 | –60 Ideal 4th Order Lowpass –70 –80 0.01 0.1 1 10 100
in „OP-Schaltung: Rechteck zu Sinus“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
0900766b80060b32.pdf
........................................................................ 5 2.1.1 Serial Connector, ST1 at main PCB and X1 at RWD........................................................ 5 2.1.2 Parallel Connector, ST2 at main PCB and X2 at RWD..................................................... 5 2.1.3
in „[V] Altes RFID Mifare Philips Eval Kit (1998)..“ · Markt ·
-
PDF
HD66766-10.pdf
2001 Restrictions on the 1st/2nd Screen Driving Position Register Settings The following restrictions must be satisfied when setting the start line (SS17-10) and end line (SE17-10) of the 1st screen driving position register (R14h
in „The Siemens S65 132x176, 65536 color display with AVR“ · Projekte & Code ·
-
Datei
test.lst
: 176 .LBE73: 177 .LBE72: 178 .LBE71: 179 .LBB82: 180 .LBB83: 181 .LM22: 182 006c 8AE0 ldi r24,lo8(10) 183 006e F82E mov r15,r24 184 .LBE83: 185 .LBE82: 186 .LM23: 187 0070 8E01 movw r16,r28 188 0072 0F5F subi r16,lo8(-(1)) 189 0074 1F4F sbci r17,hi8(-(1)) 190 .LM24: 191 0076 DE01 movw r26,r28 192 0078
in „UART sendet nicht das was er soll (kein offset problem)“ · Mikrocontroller und Digitale Elektronik ·
-
Thread
User code auf Eval-Board ET-STM32
" -c -fmessage-length=0 -MMD -MP -MF"startup_stm32f10x_hd.d" -MT"startup_stm32f10x_hd.d" -mcpu=cortex-m3 -mthumb -g3 -gdwarf-2 -o "startup_stm32f10x_hd.o" "../startup_stm32f10x_hd.S" ../startup_stm32f10x_hd.S: Assembler messages: ../startup_stm32f10x_hd.S
irqhandler' ../startup_stm32f10x_hd.S:276: Error: bad instruction `dma1_channel2_irqhandler' ../startup_stm32f10x_hd.S:277: Error: bad instruction `dma1_channel3_irqhandler' ../startup_stm32f10x_hd.S:278: Error: bad instruction
Mikrocontroller und Digitale Elektronik ·Klaus · ·7 Antworten
-
PDF
KMI16_1.pdf
s f output signal fall time 10% to 90% 0.1 0.4 10 s δ duty cycle Tamb= −40 to +150 °C 30 50 70 % dmin minimum sensing distance Tamb= −40 to +150 °C − 0.3 0.5 mm dmax maximum sensing distance T amb= −40 to
in „Datenblätter Kfz-Hallsensoren wo?“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
digit32.pdf
) (vl IDjlF UtWI C| !■-, 3n 31sn1 cnecigItoisl,,1,adNofhedgbordonctr,Aoid Using the Sampler lgtheamlrinoteUerPr,cnectyouuiosucetohe goudpaeiamstoesueteroe,niefeoprtonftior anyhreetoicici. aplrsiputPhnojck2,andurnouromuero
in „LM358 als Verstärker - stimmt das denn so?“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
Switch.pdf
SP4-PL2-DC5V D 10 5 4 Form C Plug-In ST-SERIE Für größere Mengen als aufgelistet, bitte telefonisch ein Angebot einholen. 769-ST1-DC12V-F ST1-DC12V-F E 8 12 1 Form A/1 Form B PCB 769-ST1-DC24V-F ST1-DC24V-F E 8 24 1 Form
in „Ausfallursache Printtaster DeLonghi Kaffeeautomat?“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
LT1083_LT1084_LT1085_LT.pdf
I 30 I 30 20 R R 20 CADJ = 200 F AT FREQUENCIES < 60Hz 20 VOUT = 5V CADJ = 25 F AT FREQUENCIES > 60Hz CADJ = 25 F 10 LT1084CK 10 IOUT= 5A 10 COUT = 25 F 0 0 0 10 100 1k 10k 100k 0 1 2 3 4 5 50 60 70 80 90 100 110 120 130 140 150 FREQUENCY
in „Aus 12V 5V machen“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
LT1085.pdf
I 30 I 30 20 R R 20 CADJ = 200 F AT FREQUENCIES < 60Hz 20 VOUT = 5V CADJ = 25 F AT FREQUENCIES > 60Hz CADJ = 25 F 10 LT1084CK 10 IOUT= 5A 10 COUT = 25 F 0 0 0 10 100 1k 10k 100k 0 1 2 3 4 5 50 60 70 80 90 100 110 120 130 140 150 FREQUENCY
in „LT1085 parallel“ · Analoge Elektronik und Schaltungstechnik ·
-
Datei
fcntl.lst
adiw r30,2 84 .stabn 68,0,33,.LM4-fcntl_init 85 .LM4: 86 000c 8F5F subi r24,lo8(-(1)) 87 000e 8A30 cpi r24,lo8(10) 88 0010 D8F3 brlo .L5 89 .LBE2: 90 /* epilogue: frame size=0 */ 91 0012 0895 ret 92 /* epilogue end (size=1) */ 93 /* function fcntl_init size 10 (9)
in „Compiler-Fehler?“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
ST7789V.pdf
-line 8bit serial I/SDA: in/out DGND/VDDI DB[17:10], 1 0 0 0 80-16bit parallel I/F Ⅱ DB[8:1] 1 0 0 1 80-8bit parallel I/F ⅡDB[17:10] 1 0 1 0 80-18bit parallel I/F DB[17:0], 1 0 1 1 80-9bit parallel I/F Ⅱ DB[17:9] SDA: in/ 1 1 0 1 3-line 9bit serial I
in „LilyGo T-Watch 2020 v1 Micropython“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
ST7735S.pdf
SCL “H” Pulse Width (Read) 60 ns Data Ram TSLR SCL “L” Pulse Width (Read) 60 ns TDCS D/CX Setup Time 10 ns D/CX TDCH D/CX Hold Time 10 ns TSDS Data Setup Time 10 ns SDA TSDH Data Hold Time 10 ns For Maximum CL=30pF (DIN) TACC Access Time 10 50 ns For Minimum CL=8pF (DOUT) TOH Output Disable Time 15 50
in „[STM32/HAL] Treiber für ST7735 160 x 80 TFT“ · Projekte & Code ·
-
PDF
Dissertation.pdf
crescentus, 6: Enterococcus faecium (B), 7: E. faecium (DSM), 8: E. faecalis, 9: E. casseliflavus, 10: Negativ-Kontrolle. M: 100 bp-Marker. A) Vorwärtsprimer rA2F (Position 197-219) rA2F -------------------CGGAATTCTCGGGCAAGACCACC-------- 23 Pseudomonas putidanosa ATCGTCGAGATCTACGGCCCGGAATCGTCGGGTAAAACCACGCTGACCCT
in „UVC Wasserentkeimung mit Led?“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
iPhone_4_schem.pdf
A1_GND 4 17 UART3_RTS_L UART_ST UART3_RTSN J18 1 17 UART3_CTS_L AD5 UART3_CTSN UART5_RTXD V8 BATTERY_SWI 11 GAS GAUGE 11 KEEPACT C10 GPIO19 SMII_RXD A27_GND 4 3 UART_ST 17 15 GRAPE_RESET_L F10 GPIO20 SMII_SYNC G19 SPKR_AMP_EN 14 AD2
in „iphone 4 smd abgebrochen“ · Mikrocontroller und Digitale Elektronik ·
-
Thread
DDR Schach-Computer Chess Master Diamond reparieren (Dauerton)
Jim K. schrieb im Beitrag #6615238: > PM 10 und PM11. > Ich habe eben das PM10. PM10 ist eine Erweiterung für die Eröffnung, PM11 eine für das Endspiel.
Modulnamen geführt haben. CS2|CS1: 00b - Grundgerät ROM1 01b - Grundgerät ROM2 --------------------- 10b - PM10 --------------------- 10b - PM11 ROM1 11b - PM11 ROM2
Mikrocontroller und Digitale Elektronik ·Jim K. · ·242 Antworten
-
PDF
HD66766R.PDF
2002 Restrictions on the 1st/2nd Screen Driving Position Register Settings The following restrictions must be satisfied when setting the start line (SS17-10) and end line (SE17-10) of the 1st screen driving position register (R14h
in „LCD-Modul F51661GNCJU-MLW-AA * Info *“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
TDA1591.pdf
stereo decoder and noise blanker TDA1591 MEH032 handbook, full pagewidth αcs (dB) (1) 40 30 20 (2) 10 0 10 102 10 3 104 f (Hz) 105 oAF (1) Coupling capacitoK C at pin 20 = 10 F. (2) Coupling capacitoK C at pin 20 = 0.1 F. Fig.6 Channel separation as a function of audio frequency. MEH033 2 handbook, full
in „TDA 7313 input AM / FM“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
ucn5833_datasheet.pdf
l One output ON, l = 100 mA — 1.0 mA DD OUT All outputs OFF — 50 µA Output Rise Time t l = 100 mA, 10% to 90% — 500 ns r OUT Output Fall Time t l = 100 mA, 90% to 10% — 500 ns f OUT NOTE: Positive (negative) current is defined as going into (coming out of) the specified device pin. TRUTH TABLE Serial
in „AT89C2051 und das UART Rätsel“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
PHI.pdf
temperature error for KTY81-152 Icont 1 mA. AMBIENT TEMPERATURE KTY81-152 RESISTANCE ( ) TEMP. (°C) (°F) (%/K) ERROR MIN. TYP. MAX. (K) −55 −67 0.99 480 502 525 ±4.52 −50 −58 0.98 505 528 551 ±4.45 −40 −40 0.96 558 582 606 ±4.3 −30 −22 0.93 614 639 664 ±4.16 −20 −4 0.91 675 701 726 ±4.01 −10 14 0.88 740
in „Genauere Messung der Temperatur“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
KTY81-2_PHI.pdf
−10 14 0.88 1480 1532 1584 ±3.84 0 32 0.85 1618 1670 1723 ±3.67 10 50 0.83 1764 1817 1869 ±3.48 20 68 0.80 1919 1970 2022 ±3.28 25 77 0.79 2000 2050 2100 ±3.18 30 86 0.78 2077 2132 2187 ±3.33 40 104 0.75
in „KTY 81 110 an Mega“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
PHI.pdf
−10 14 0.88 1480 1532 1584 ±3.84 0 32 0.85 1618 1670 1723 ±3.67 10 50 0.83 1764 1817 1869 ±3.48 20 68 0.80 1919 1970 2022 ±3.28 25 77 0.79 2000 2050 2100 ±3.18 30 86 0.78 2077 2132 2187 ±3.33 40 104 0.75
in „Kurze Frage zwecks Vorwiderstand für Sensor.“ · Mikrocontroller und Digitale Elektronik ·
-
Datei
nano_os_2_OPTs.txt
->stack + sizeof(t->stack) - 3); 1bc: fd 01 movw r30, r26 1be: ee 5b subi r30, 0xBE ; 190 1c0: ff 4f sbci r31, 0xFF ; 255 1c2: 8f e1 ldi r24, 0x1F ; 31 for (a=31; a>=0; a--) *s-- = 0; 1c4: 10 82 st Z, r1 1c6: 31 97 sbiw r30, 0x01 ; 1 1c8: 81 50 subi r24, 0x01 ; 1 1ca: e0 f7 brcc .-8 ; 0x1c4 <task_create
-
Datei
nano_os_OPTs.txt
->stack + sizeof(t->stack) - 3); 206: fd 01 movw r30, r26 208: ee 5b subi r30, 0xBE ; 190 20a: ff 4f sbci r31, 0xFF ; 255 20c: 8f e1 ldi r24, 0x1F ; 31 for (a=31; a>=0; a--) *s-- = 0; 20e: 10 82 st Z, r1 210: 31 97 sbiw r30, 0x01 ; 1 212: 81 50 subi r24, 0x01 ; 1 214: e0 f7 brcc .-8 ; 0x20e <task_create
-
PDF
2008T-femto-counters.pdf
period (gate time) no. of samples gate time tres= 225 ps t = 3 ps jitter (gate time) (frequency) for f < 200 kHz number of samples = (gate time) 2 10 5 for f 200 kHz RMS resolution = 00 y or T = T 00 y frequency 00 period T 00 gate time < 200 kHz no. of samples n = 00 00 2 10 5 00 200 kHz 43 5 – Advanced