-
PDF
Dissertation.pdf
------------GAAACCACC 11 Pseudomonas aeruginosa AGATCCGCATGAAGATCGGCGTCATG---TTCGGCAACCCGGAAACCACC 624 Pseudomonas putida AGATCCGTATGAAGATCGGCGTAATG---TTCGGCAGCCCGGAAACCACC 624 Burkholderia cepacia AGATCCGCATGAAGATCGGCGTGATG---TTCGGCAACCCGGAAACCACG 847 Caulobacter crescentus AGATCCGTCACAAGATCGGGGTGATG
in „UVC Wasserentkeimung mit Led?“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
DE200610__1_.pdf
- mentenverstärker“,diesichfürBiosig- nale im Prinzip sehr gut eignen. Ein 0 Beispiel wäre der Typ AD624. Leider 1V75 4V25 gibt es auch Nachteile: Es ist ein VECG 050280 - 14 Abgleich erforderlich und Kosten und Stromverbrauchsindhoch. Für unsere Zwecke eignen sich auch normale Bild 5. Die Übertragungsfunktion
in „ekg schaltung aus heft 10/2006“ · Analoge Elektronik und Schaltungstechnik ·
-
Datei
stm32f10x_rcc.lst
align 2 620 .global RCC_PCLK1Config 621 .thumb 622 .thumb_func 623 .type RCC_PCLK1Config, %function 624 RCC_PCLK1Config: 625 .LFB34: 414:lib/stm32f10x_rcc.c **** 415:lib/stm32f10x_rcc.c **** /** 416:lib/stm32f10x_rcc.c **** * @brief Configures the Low Speed APB clock (PCLK1). 417:lib/stm32f10x_rcc.c *
in „Seltsame Initialisierungen und Abstürze.“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
TPN15.1E_LA.pdf
VIEW SGND 1 16 PGND BYPASS 2 15 SW 8. TPN15.1E LA IC Data Sheets agram 10-7-11 SPK AMP/HP OUT, B11, AD87588 (IC U601) Block diagram AD87588 Pinning information Block Diagrams TPN15.1E LA 9. EN 55 9. Block Diagrams 9.1 Block diagram 4x00/6300/5210 series 19790_400.eps back to 2015-Oct-20div.table Circuit
in „Philips 6300 TV Bildfehler "fading"“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
ttester.pdf
werden die Analogschalter 74HC4052 benutzt. Die Tabelle 2.2 zeigt die Pinbelegung für den ATmega324/624/1284 Mikrocontroller für verschiedene Display Anschlüsse. Port Character LCD Graphik LCD Zusatzfunktion ST7565 PB2 LCD-RS PB3 LCD-E PB4 LCD-D4 LCD-REST PB5 LCD-D5 LCD-RS ISP-MOSI Drehgeber 2 PB6 LCD-D6
-
PDF
ttester.pdf
werden die Analogschalter 74HC4052 benutzt. Die Tabelle 2.2 zeigt die Pinbelegung für den ATmega324/624/1284 Mikrocontroller für verschiedene Display Anschlüsse. Port Character LCD Graphik LCD Zusatzfunktion ST7565 PB2 LCD-RS PB3 LCD-E PB4 LCD-D4 LCD-REST PB5 LCD-D5 LCD-RS ISP-MOSI Drehgeber 2 PB6 LCD-D6
-
PDF
ttester.pdf
werden die Analogschalter 74HC4052 benutzt. Die Tabelle 2.2 zeigt die Pinbelegung für den ATmega324/624/1284 Mikrocontroller für verschiedene Display Anschlüsse. Port Character LCD Graphik LCD Zusatzfunktion ST7565 PB2 LCD-RS PB3 LCD-E PB4 LCD-D4 LCD-REST PB5 LCD-D5 LCD-RS ISP-MOSI Drehgeber 2 PB6 LCD-D6
-
Datei
debug_okay.asm
20 02 call 0x440 ; 0x440 <spi_transfer_byte> 620: 61 e0 ldi r22, 0x01 ; 1 622: ce 01 movw r24, r28 624: 01 96 adiw r24, 0x01 ; 1 626: 0e 94 37 02 call 0x46e ; 0x46e <spi_transmit> 62a: 5d 9a sbi 0x0b, 5 ; 11 spi_transmit_sync( &payloadWidth, 1); // Get payload width §§ korrekt? ) #ifdef DEBUG2 PORTC
in „Fehler bei einfacher Integer-Division?“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
CY7C68013.pdf
1 EP4AUTOINLENL Endpoint 4 AUTOIN Packet PL7 PL6 PL5 PL4 PL3 PL2 PL1 PL0 00000000 RW [6] Length L E624 1 [6]AUTOINLENH Endpoint 6 AUTOIN Packet 0 0 0 0 0 PL10 PL9 PL8 00000010 rrrrrbbb Length H E625 1 EP6AUTOINLENL Endpoint 6 AUTOIN Packet PL7 PL6 PL5 PL4 PL3 PL2 PL1 PL0 00000000 RW [6] Length L E626
-
PDF
CY7C68013.pdf
1 EP4AUTOINLENL Endpoint 4 AUTOIN Packet PL7 PL6 PL5 PL4 PL3 PL2 PL1 PL0 00000000 RW [6] Length L E624 1 [6]AUTOINLENH Endpoint 6 AUTOIN Packet 0 0 0 0 0 PL10 PL9 PL8 00000010 rrrrrbbb Length H E625 1 EP6AUTOINLENL Endpoint 6 AUTOIN Packet PL7 PL6 PL5 PL4 PL3 PL2 PL1 PL0 00000000 RW [6] Length L E626
in „Stereokamera CY7C68013A + 2 mal MT9D131“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
HX8352-A.pdf
: : : : : 127 G 627 G 626 G625 G 624 G 623 G 622 G 621 G 620 128 G 637 G 636 G635 G 634 G 633 G 632 G 631 G 630 129 B 007 B 006 B005 B 004 B 003 B 002 B001 B 000 130 B 017 B 016 B015 B 014 B 013 B 012 B011 B 010 : : : : : : : : : : : : : : : : : : 101 B 627 B 626 B625 B 624 B 623 B 622 B621 B 620 192 B 637 B 636 B635 B 634 B 633 B 632 B631 B 630 6.45 Test mode control register (R83h) Figure 6. 80 TEST MODE Control Register (R83h) When TEST_MODE=1, then in-housedregister
-
PDF
1_AMD_BKDG_Family__15h_Mod_00h-0Fh_BKDG.pdf
53BC 53AF 5366 9153 F053 7853 5E53 2F53 BC53 AF53 6653 54 5400 0054 5454 542A 5415 54B2 54EE 5477 54AD 5483 5426 2A54 1554 B254 EE54 7754 AD54 8354 2654 55 5500 0055 5555 5592 5549 559C 5528 5514 5550 550A 55BB 9255 4955 9C55 2855 1455 5055 0A55 BB55 56 5600 0056 5656 562B 56AD 56EE 5613 56B1 5626 56E0
-
Datei
hrktar_main.lst
ANF + 11 Adresse (R1) 620: 1 ; ANF + 12 Vorzeichenmaske 621: 1 ; 622: 1 623: 1 N 0070 ANF EQU 70H 624: 1 625: 1 ; Parameter Konvertierung CONBCD BIN --> 626: 1 N 0043 BINLSB_BCD EQU 43H ; BIN W 627: 1 N 0040 BINMSB_BCD EQU 40H ; BIN W 628: 1 N 003F ZWSLSB_BCD EQU 3FH ; Zwisc 629: 1 N 0029 BCDLSB_BCD
in „8051 Assembler + Linker für WINDOWS 10/11“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
AoE3_chapter9.pdf
Real-time I/O 992 13.11.1 ADE7753 multifunction ac power metering IC 943 14.1.6 Data bus 992 13.11.2 AD7873 touchscreen digitizer 944 14.2 A computer instruction set 993 13.11.3 AD7927 ADC with sequencer 945 14.2.1 Assembly language and 13.11.4 AD7730 precision machine language 993 bridge-measurement subsystem
in „Labornetzgerät - Fragen zum Schaltplan“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
slau144j.pdf
following fields: src The source operand defined by As and S-reg dst The destination operand defined by Ad and D-reg As The addressing bits responsible for the addressing mode used for the source (src) S-reg The working register used for the source (src) Ad The addressing bits responsible for the addressing
in „MSP430 Gleitkommazahl in Flash speichern“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
family_guide.pdf
following fields: src The source operand defined by As and S-reg dst The destination operand defined by Ad and D-reg As The addressing bits responsible for the addressing mode used for the source (src) S-reg The working register used for the source (src) Ad The addressing bits responsible for the addressing
in „MSP430 Output nur auf zwei von vier Pinnen möglich?“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
Yaskawa-SGDB-xxADx-x-TSE-S800-16E.pdf
Σ-SERIES PRODUCTS 2.3.3 Connection to Host Controllercont. J Connection to MITSUBISHI Positioning Unit AD72 SERVOPACK for Speed/Torque Control SERVOPACK SGDB-jjADj Speed/Torque I/O power supply AD72 (Made by MITSUBISHI) positioning is stopped) (ON when proximity /S-ON is detected) 2 Speed reference /PBO
-
Datei
R6581.txt
fH. 1N^NuNV JEf*"y p:N fH. 1N^NuNV *"y f<"y HD0 HD @HD0 "DT fj. p:N "D=Q `PG f "DC PQ~ 89N^NuNV JEf adJy >&9 g4. HG0 HG @HG0 `P.9 */< 4zX *G"n 9N^NuNV nJEf 4zX 89N^NuNV N^NuNV OnJff.9 OnN fPBy OnJHx f$Jy On.f N^NuNV g&B N^NuNV BT# BQBDJ :f JDgl"n JDf fF# `8"y g0"y T"y BQ` `,"y 81N^NuNV 1N^Nu? ?tz {?@bM
in „Hilfe bei Disassembler 68000 Binary“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
MSP430FR59xx.pdf
.. 22.4.2 UCBxCTLW1 Register ......................................................................624............... 22.4.3 UCBxBRW Register .........................................................................626............... 22.4.4 UCBxSTATW ..................................................
in „Probleme mit Konfiguration der SPI-Schnittstelle am MSP430“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
MSP430FR59xx.pdf
.. 22.4.2 UCBxCTLW1 Register ......................................................................624............... 22.4.3 UCBxBRW Register .........................................................................626............... 22.4.4 UCBxSTATW ..................................................
in „Schaltung für Vibrationsmessung mit Piezo“ · Analoge Elektronik und Schaltungstechnik ·
-
Datei
DeviceList.txt
PLCC32) TMS27C080(TSOP32) TOSHIBA========== nos=31 TMM2716 TMM2732 TMM27C32 TMM2764 TMM2764A TMM2764AD TMM2764ADI TMM2764AP TMM27128 TMM27128A TMM27128ADI TMM27128AP TMM27256A TMM27256AD TMM27256B TMM27256D TMM27512 TMM27512B TMM27512DI TMM27C010 TMM27C010(PLCC32) TMM27C010(TSOP32) TMM27C020 TMM27C020
in „[V] Genius G540 EPROM/Flash/uC Programmer (USB)“ · Markt ·
-
PDF
Lang_CDDA.pdf
(1/2), Jan./Feb. 1981, 2Digital Audio Technical Committee Report. AppenlAES229 (9) Sep 1981, S.620-624 ' 3ebenda , Digital Audio Technical Committee Report. AppenlAES229 (9), Sep 4 van Tilburg, J.J.G.Ch. Interview 2. Dez. 1993,6B 202-207 1981, S.620-624 Im Original: ,,[...] a great deal of interest was
in „Sample Frequenz 48 KHz vs. 44 KHz“ · Digitale Signalverarbeitung / DSP / Machine Learning ·
-
PDF
onkyo_tx_nr_616_service_manual.pdf.pdf
push POWER button. N R 6 1 6 D x 2 0 0 0 MODEL Name Destination A B C D Dx : USA/Canada A:Value of AD port of BAND DF : Taiwan B:Value of AD port of INIT1 xx : Other(Europe, Asia):Value of AD port of INIT2 JJ : Japan D:Value of AD port of INIT3 MODEL TX-NR515 TX-NR515AE HT-RC460 HT-R791 DTR-20.4 FL DIS
in „Onkyo verstärker“ · Analoge Elektronik und Schaltungstechnik ·
-
PDF
SMD_Catalog.pdf
6.2V 0.3W zener 622 PZM6.2NB2 Phi C SOT346 6.2V 0.3W zener 623 PZM6.2NB3 Phi C SOT346 6.2V 0.3W zener 624 FMMT624 Zet N SOT23 - 625 FMMT625 Zet N SOT23 - 634 FMMT634 Zet N SOT23 100V 0.9A darlington npn 651 PZT651 Mot N SOT223 npn 60V 1A 681 PZM6.8NB1 Phi C SOT346 6.8V 0.3W zener 682 PZM6.8NB2 Phi C SOT346
in „Hilfe bei Bauteilsuche für Mainboard“ · PC Hard- und Software ·
-
PDF
VHF-COMM.1984.3.pdf
R 634 Resistor 3.9 0 1 R 626 Resistor 1011 1 R 625 Resistor 90 n 2 R 620, R 621 Resistor 820c 1 R 624 Resistor 900 0 1 R632 Resistor 1kD 1 R623 Resistor 9 kO 8 R 601, Resistor -osc R604 - R 608 R 627 - R 631 16 R 609 - R 619 Resistor 47 kO R 637 - R 641 2 R 602, R 603 Resistor 82 kO 1 R 622 Resistor
-
PDF
VHF-COMM.1984.3.pdf
R 634 Resistor 3.9 0 1 R 626 Resistor 1011 1 R 625 Resistor 90 n 2 R 620, R 621 Resistor 820c 1 R 624 Resistor 900 0 1 R632 Resistor 1kD 1 R623 Resistor 9 kO 8 R 601, Resistor -osc R604 - R 608 R 627 - R 631 16 R 609 - R 619 Resistor 47 kO R 637 - R 641 2 R 602, R 603 Resistor 82 kO 1 R 622 Resistor
-
PDF
CY7C68016A.pdf
EP4AUTOINLENL [11Endpoint 4 AUTOIN PL7 PL6 PL5 PL4 PL3 PL2 PL1 PL0 00000000 RW Packet Length L [11] E624 1 EP6AUTOINLENH Endpoint 6 AUTOIN 0 0 0 0 0 PL10 PL9 PL8 00000010 rrrrrbbb Packet Length H E625 1 EP6AUTOINLENL [11Endpoint 6 AUTOIN PL7 PL6 PL5 PL4 PL3 PL2 PL1 PL0 00000000 RW Packet Length L [11]
in „CY7C68013A-56pins“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
Spezifikation.pdf
MASTER ADDRESS 1 A DATA A DATA A P ▯▯▯▯▯▯▯▯▯▯ (B) general second (n bytes + ack.) call address byte MBC624 Fig.16 Data transfer from a hardware master-transmitter. an interface, it must constantly monitor the bus via In some systems, an alternative could be that the hardware master transmitter is set in
in „SPI, ISP, USI, TWI, I2C“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
Spezifikation.pdf
MASTER ADDRESS 1 A DATA A DATA A P ▯▯▯▯▯▯▯▯▯▯ (B) general second (n bytes + ack.) call address byte MBC624 Fig.16 Data transfer from a hardware master-transmitter. an interface, it must constantly monitor the bus via In some systems, an alternative could be that the hardware master transmitter is set in
-
PDF
Spezifikation.pdf
MASTER ADDRESS 1 A DATA A DATA A P ▯▯▯▯▯▯▯▯▯▯ (B) general second (n bytes + ack.) call address byte MBC624 Fig.16 Data transfer from a hardware master-transmitter. an interface, it must constantly monitor the bus via In some systems, an alternative could be that the hardware master transmitter is set in
in „I²c mit Bascom und ATmega“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
Spezifikation.pdf
MASTER ADDRESS 1 A DATA A DATA A P ▯▯▯▯▯▯▯▯▯▯ (B) general second (n bytes + ack.) call address byte MBC624 Fig.16 Data transfer from a hardware master-transmitter. an interface, it must constantly monitor the bus via In some systems, an alternative could be that the hardware master transmitter is set in
in „Reset auf I2C-Bus“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
Philips_Semiconductors_-_I2C_Bus_Specification_v2.1.pdf
MASTER ADDRESS 1 A DATA A DATA A P ▯▯▯▯▯▯▯▯▯▯ (B) general second (n bytes + ack.) call address byte MBC624 Fig.16 Data transfer from a hardware master-transmitter. an interface, it must constantly monitor the bus via In some systems, an alternative could be that the hardware master transmitter is set in
in „GND-Fäche sinnvoll???“ · Platinen ·
-
PDF
Spezifikation.pdf
MASTER ADDRESS 1 A DATA A DATA A P ▯▯▯▯▯▯▯▯▯▯ (B) general second (n bytes + ack.) call address byte MBC624 Fig.16 Data transfer from a hardware master-transmitter. an interface, it must constantly monitor the bus via In some systems, an alternative could be that the hardware master transmitter is set in
in „i2c und Takt“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
Spezifikation.pdf
MASTER ADDRESS 1 A DATA A DATA A P ▯▯▯▯▯▯▯▯▯▯ (B) general second (n bytes + ack.) call address byte MBC624 Fig.16 Data transfer from a hardware master-transmitter. an interface, it must constantly monitor the bus via In some systems, an alternative could be that the hardware master transmitter is set in
-
PDF
Spezifikation.pdf
MASTER ADDRESS 1 A DATA A DATA A P ▯▯▯▯▯▯▯▯▯▯ (B) general second (n bytes + ack.) call address byte MBC624 Fig.16 Data transfer from a hardware master-transmitter. an interface, it must constantly monitor the bus via In some systems, an alternative could be that the hardware master transmitter is set in
in „I2C Speicher HotSwap?“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
Spezifikation.pdf
MASTER ADDRESS 1 A DATA A DATA A P ▯▯▯▯▯▯▯▯▯▯ (B) general second (n bytes + ack.) call address byte MBC624 Fig.16 Data transfer from a hardware master-transmitter. an interface, it must constantly monitor the bus via In some systems, an alternative could be that the hardware master transmitter is set in
in „I²C Bus Schnittstelle extern ?“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
I2C_BUS_SPECIFICATION_3.pdf
MASTER ADDRESS 1 A DATA A DATA A P ▯▯▯▯▯▯▯▯▯▯ (B) general second (n bytes + ack.) call address byte MBC624 Fig.16 Data transfer from a hardware master-transmitter. an interface, it must constantly monitor the bus via In some systems, an alternative could be that the hardware master transmitter is set in
in „SPI oder TWI“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
Spezifikation.pdf
MASTER ADDRESS 1 A DATA A DATA A P ▯▯▯▯▯▯▯▯▯▯ (B) general second (n bytes + ack.) call address byte MBC624 Fig.16 Data transfer from a hardware master-transmitter. an interface, it must constantly monitor the bus via In some systems, an alternative could be that the hardware master transmitter is set in
in „Unterschied Defintion I²C und SPI“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
i2c_bus_specification_3.pdf
MASTER ADDRESS 1 A DATA A DATA A P ▯▯▯▯▯▯▯▯▯▯ (B) general second (n bytes + ack.) call address byte MBC624 Fig.16 Data transfer from a hardware master-transmitter. an interface, it must constantly monitor the bus via In some systems, an alternative could be that the hardware master transmitter is set in
in „IIC-Bus Verständnisfrage“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
I2C_SPEC.pdf
MASTER ADDRESS 1 A DATA A DATA A P ▯▯▯▯▯▯▯▯▯▯ (B) general second (n bytes + ack.) call address byte MBC624 Fig.16 Data transfer from a hardware master-transmitter. an interface, it must constantly monitor the bus via In some systems, an alternative could be that the hardware master transmitter is set in
in „I2C abstrakt“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
I2C_SPEC.pdf
MASTER ADDRESS 1 A DATA A DATA A P ▯▯▯▯▯▯▯▯▯▯ (B) general second (n bytes + ack.) call address byte MBC624 Fig.16 Data transfer from a hardware master-transmitter. an interface, it must constantly monitor the bus via In some systems, an alternative could be that the hardware master transmitter is set in
in „I2C programmieren lernen“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
39340011.pdf
MASTER ADDRESS 1 A DATA A DATA A P ▯▯▯▯▯▯▯▯▯▯ (B) general second (n bytes + ack.) call address byte MBC624 Fig.16 Data transfer from a hardware master-transmitter. an interface, it must constantly monitor the bus via In some systems, an alternative could be that the hardware master transmitter is set in
in „Problem mit I²C-Device“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
I2C_SPEC.pdf
MASTER ADDRESS 1 A DATA A DATA A P ▯▯▯▯▯▯▯▯▯▯ (B) general second (n bytes + ack.) call address byte MBC624 Fig.16 Data transfer from a hardware master-transmitter. an interface, it must constantly monitor the bus via In some systems, an alternative could be that the hardware master transmitter is set in
in „was bedeutet acknowleges bei SPI“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
philips_i2c.pdf
MASTER ADDRESS 1 A DATA A DATA A P ▯▯▯▯▯▯▯▯▯▯ (B) general second (n bytes + ack.) call address byte MBC624 Fig.16 Data transfer from a hardware master-transmitter. an interface, it must constantly monitor the bus via In some systems, an alternative could be that the hardware master transmitter is set in
in „wie sieht ein i2c protokoll aus?“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
MC9S12XF512.pdf
. . . . . 718 16.3.73Port AD Reduced Drive Register 0 (RDR0AD) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 719 16.3.74Port AD Reduced Drive Register 1 (RDR1AD) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 720 16.3.75Port AD Pull Up Enable Register 0 (PER0AD) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 720 16.3.76Port AD Pull Up Enable Register 1 (PER1AD) . . . . . . . . . . . . . . . . . . . . . . . .
in „Wie oft kann ein µC programmiert werden?“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
MC9S12XF512.pdf
. . . . . 718 16.3.73Port AD Reduced Drive Register 0 (RDR0AD) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 719 16.3.74Port AD Reduced Drive Register 1 (RDR1AD) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 720 16.3.75Port AD Pull Up Enable Register 0 (PER0AD) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 720 16.3.76Port AD Pull Up Enable Register 1 (PER1AD) . . . . . . . . . . . . . . . . . . . . . . . .
in „Probleme beim Ansteuern eines EEPROM über SPI“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
LG4573A_DS_V1.1.5__1_.pdf
................................................................................19 5.1.1 Write/ Re ad Cycle Sequence...................................................................................19 5.2 MIPI DB I Type C ..............................................................................
-
PDF
Modbus_RTU___Kommunikationshandbuch_fuer_EATON_DC1.pdf
P6-22 Reset Lüfterlaufzeit rw RUN 1 ≙ 1 0, 1 WORD 623 P6-23 Reset kWh Zähler rw RUN 1 ≙ 1 0, 1 WORD 624 P6-24 Service Intervall Zeit rw RUN 1 ≙ 1 0 - 60 000 h (0 = disabled)U16 625 P6-25 Reset ServiceAnzeige rw RUN 1 ≙ 1 0 -1 WORD 626 P6-26 AO1 Skalierung rw RUN 1 ≙ 0.1 0 - 5000 U16 627 P6-27 AO1 Offset
in „ich bitte um Mitt-Hilfe in Sachen RS485; Modbus; Frquenzumrichter; qModMaster“ · Mikrocontroller und Digitale Elektronik ·
-
PDF
Anleitung.pdf
der Samsung Smart Control gedrückt. Alternativ können Sie auf der Standardfernbedienung die Taste AD/SUBT. drücken. Im Menü Schnelltasten für Barrierefreiheit können Sie zwischen den Optionen Voice Guide, Audio f. Sehgesch., Untertitel, Menütransparenz, Hoher Kontrast, Vergrößern, Fernbedienung erkennen
in „Möchte in mein Heimnetz streamen, weiss aber nicht wie. :-(“ · PC Hard- und Software ·
-
PDF
harman_kardon_avr145_sm.pdf
ELECT 100UF 16V 1 C620 CCEA1CH101T CAP , ELECT 100UF 16V 1 C622 CCEA1CH101T CAP , ELECT 100UF 16V 1 C624 CCEA1CH101T CAP , ELECT 100UF 16V 1 C626 CCEA1CH101T CAP , ELECT 100UF 16V 1 C628 CCEA1CH101T CAP , ELECT 100UF 16V 1 C630 CCEA1CH101T CAP , ELECT 100UF 16V 1 C703 CCEA1CH101T CAP , ELECT 100UF 16V
in „Relais beim AVR 145 von harman/kardon durch SSR ersetzen“ · Analoge Elektronik und Schaltungstechnik ·